ID: 1193383579

View in Genome Browser
Species Human (GRCh38)
Location X:80844848-80844870
Sequence CTATGCCTGTAGAAATATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193383579_1193383583 8 Left 1193383579 X:80844848-80844870 CCAGGATATTTCTACAGGCATAG No data
Right 1193383583 X:80844879-80844901 AGGGAGCAAGGCTGCAATCATGG No data
1193383579_1193383582 -4 Left 1193383579 X:80844848-80844870 CCAGGATATTTCTACAGGCATAG No data
Right 1193383582 X:80844867-80844889 ATAGTAAAACATAGGGAGCAAGG No data
1193383579_1193383584 21 Left 1193383579 X:80844848-80844870 CCAGGATATTTCTACAGGCATAG No data
Right 1193383584 X:80844892-80844914 GCAATCATGGCAAAAGTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193383579 Original CRISPR CTATGCCTGTAGAAATATCC TGG (reversed) Intergenic
No off target data available for this crispr