ID: 1193385875

View in Genome Browser
Species Human (GRCh38)
Location X:80871327-80871349
Sequence CCTCCAGTTCAGAAGGATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193385875 Original CRISPR CCTCCAGTTCAGAAGGATCA TGG Intergenic