ID: 1193391072

View in Genome Browser
Species Human (GRCh38)
Location X:80929892-80929914
Sequence ACATTGTTGGGCCTTCCATC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 4, 2: 1, 3: 4, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193391069_1193391072 0 Left 1193391069 X:80929869-80929891 CCTGGGCTGCGACATGGTTTTCG 0: 1
1: 1
2: 0
3: 9
4: 86
Right 1193391072 X:80929892-80929914 ACATTGTTGGGCCTTCCATCCGG 0: 1
1: 4
2: 1
3: 4
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193391072 Original CRISPR ACATTGTTGGGCCTTCCATC CGG Intergenic
904674948 1:32193354-32193376 AAATTGTTGGGCCTGCCTTCAGG + Intronic
906137873 1:43512945-43512967 GCCTTGCTGGGCCTTCCATGGGG - Intergenic
912116839 1:106417905-106417927 AGATTGTTGAGCCTTCTATTTGG - Intergenic
912623623 1:111190191-111190213 ACAGCTTTGGGCCTTCCAGCAGG + Intronic
917503573 1:175607700-175607722 TCACTGTTGGCCCTTCCCTCTGG - Intronic
917995572 1:180435184-180435206 ACATCGCTGGCCTTTCCATCTGG + Intronic
923424974 1:233859713-233859735 ACTTTGTTGTGTTTTCCATCAGG + Intergenic
924355887 1:243175773-243175795 ATACTGTTGAGCCTTCCAGCAGG - Intronic
1063311482 10:4956682-4956704 TCATTGTTCTGCCGTCCATCTGG + Intronic
1063316315 10:5009786-5009808 TCATTGTTCTGCCGTCCATCTGG - Intronic
1063980994 10:11451737-11451759 ACAGTCTTGGTCTTTCCATCTGG - Intergenic
1076252456 10:128995210-128995232 ACTTTGTTGGGCCGGCCTTCTGG - Intergenic
1077901044 11:6488970-6488992 ACATCACTGGACCTTCCATCTGG - Intronic
1078985655 11:16593984-16594006 ACATTGATGAGCTTTCCATGTGG + Intronic
1079833508 11:25301154-25301176 ACATTGGTGGGCCCTCCAGGTGG - Intergenic
1082251411 11:49985239-49985261 ACATTGTTGGGCATTAGACCTGG - Intergenic
1086758820 11:90601485-90601507 ACATTTTTGGCTTTTCCATCTGG + Intergenic
1086926566 11:92647089-92647111 ATAATGTTGAGCCTTCCATTTGG + Intronic
1088015781 11:105057947-105057969 AGATTCTTGAGCCTTCCTTCTGG + Intronic
1090255704 11:125282479-125282501 AGATTGCTGGGCCCTCCCTCTGG + Intronic
1097587029 12:61527452-61527474 ACCTTGCTGGGGCTTCCATTTGG - Intergenic
1099102139 12:78455786-78455808 ACACTTTTGAGTCTTCCATCCGG + Intergenic
1101633660 12:106519576-106519598 ACATTGTTGTTCTTCCCATCCGG + Intronic
1102215191 12:111156251-111156273 ACATTCCTGGTGCTTCCATCAGG - Intronic
1103017828 12:117509298-117509320 AGAGGGTTGGGCCTTCCATCAGG - Intronic
1109230283 13:59748459-59748481 ACATGGTTGGGTCTCCCATAGGG - Intronic
1111525174 13:89459031-89459053 ACATTGTTGGCCCTTTCAGATGG + Intergenic
1111843204 13:93474557-93474579 ACATAGTTGGTCCTACCTTCTGG + Intronic
1112589422 13:100749919-100749941 ACATTCTAGGGGCTTCCATTAGG - Intergenic
1115353493 14:32422654-32422676 ACATGGTTGGTCCTTCTGTCTGG + Intronic
1117752866 14:58941519-58941541 ACATTGTCTGCCCTTCCACCCGG - Intergenic
1118776122 14:68975121-68975143 ACATTGTTTGCACTTCCTTCTGG - Intronic
1121538507 14:94707763-94707785 GCAGTGTTGGGCCTTCTCTCTGG - Intergenic
1132304658 15:100802490-100802512 ACATTGTTGGGCCATTCAGCCGG + Intergenic
1136123180 16:28154723-28154745 ACTTTGTTGTGGCTTCCATTTGG - Intronic
1138445206 16:57059145-57059167 ACACTTTGTGGCCTTCCATCTGG + Intronic
1141389236 16:83650559-83650581 ACATTGTTGGGTGTCCCAGCGGG - Intronic
1143206874 17:5148633-5148655 ACAGTGTTTGGCATTCCATTGGG - Exonic
1149338908 17:55666457-55666479 ACAATGTTGGGATTTCCATCTGG - Intergenic
1149873520 17:60205559-60205581 ACAGTGTTTGGCATTCCATTGGG + Exonic
1150087304 17:62282814-62282836 ACAGTGTTTGGCATTCCATTGGG + Exonic
1150300974 17:64046690-64046712 ACATTCTGGGGGCTTCCCTCTGG + Intronic
1151632337 17:75319399-75319421 ACTTTGTTGGCCCTTCCAGTGGG - Exonic
1152793881 17:82297347-82297369 ACGGTGTTGGGCCATCCTTCCGG - Intergenic
1153829887 18:8912740-8912762 GCATTCTGTGGCCTTCCATCTGG - Intergenic
1166582000 19:43909287-43909309 ACAATGCTGGGCCTGCCAGCAGG + Intergenic
930168044 2:48222582-48222604 ACAATGTTGGCTCTTCCAACTGG - Intergenic
936080133 2:109427490-109427512 AGATTGCTGGGCCTTACACCAGG + Intronic
945258276 2:207820551-207820573 AAAGTGTTGGTCCTTCCTTCAGG - Intergenic
946412991 2:219524716-219524738 ACTAGGTTGGGCTTTCCATCTGG + Intronic
1169309005 20:4519345-4519367 GCATTGCTGGGACTTCCATTGGG + Intergenic
1170202344 20:13758803-13758825 ACATTGTTGGGCAAATCATCAGG - Intronic
1171156737 20:22881179-22881201 ACAATCCTGAGCCTTCCATCGGG - Intergenic
1174920343 20:54695372-54695394 ATAGTGTTGGGGTTTCCATCTGG + Intergenic
1176038452 20:63051783-63051805 ACAATGACGGGCCCTCCATCGGG + Intergenic
1176660325 21:9628978-9629000 ACATTGTTAGGCCCTACTTCTGG + Intergenic
1178536025 21:33411162-33411184 ACATTGTTCTGCCTTATATCCGG - Intronic
952825049 3:37517728-37517750 ACATTGATGGGCCTTCGAAGGGG - Intronic
956172222 3:66442194-66442216 TCATTGTTGGGCCATACATAGGG - Intronic
957215648 3:77317190-77317212 ACACTGCTGGGCCTTCCATCCGG - Intronic
957244620 3:77701838-77701860 ACCTTTTTGGACCTTCCAGCAGG - Intergenic
958214574 3:90545911-90545933 ACAGTGTTGGACCTTCCGTTCGG - Intergenic
958896584 3:99836413-99836435 GTATAGTTGGGCCTTCCATGTGG + Intronic
966925322 3:184640800-184640822 AGATTCTTGGTCCTTCCATTTGG + Intronic
966927069 3:184651586-184651608 ACGGTGTTAGGCCTTCCATGAGG - Intronic
967134935 3:186505082-186505104 ACATTATTAGGCTTTCCAACAGG - Intergenic
967523021 3:190457336-190457358 AAATGGTTGAGCCTTCCATGGGG - Intergenic
969540758 4:7787647-7787669 ACACTGTTGGGCCTCACCTCTGG - Intronic
972709416 4:41579510-41579532 ACATAGTTGTGCAGTCCATCTGG + Intronic
973181519 4:47274655-47274677 ACATTGTTCAGTCTTCCATTTGG - Intronic
975621769 4:76303915-76303937 ACATTATTTGGCCTTCCTTTTGG - Intronic
978375065 4:108066387-108066409 ACCTTGTTGGTCCATCCCTCAGG + Intronic
982167985 4:152632559-152632581 ACATGGTTGAGTCTTTCATCAGG + Intronic
985415033 4:189727430-189727452 ACATTGTTAGGCCCTACTTCTGG - Intergenic
988521118 5:31946422-31946444 AGATTGTTGGGCCCTCCGGCGGG + Intronic
997450726 5:133980863-133980885 ACATTGCTGGGCCTTCCATCCGG - Exonic
1003282534 6:4706341-4706363 ACATTGTAGCTCCATCCATCAGG - Intronic
1008840190 6:55893529-55893551 ACACTGCTGTTCCTTCCATCTGG + Intergenic
1016158303 6:140842892-140842914 AAATTGTTGGGGCTTGCATTAGG + Intergenic
1025863448 7:65356296-65356318 ACATTTGTGGGGATTCCATCCGG - Intergenic
1037186051 8:16064845-16064867 ACTTTGTTGGCCCTTTGATCAGG + Intergenic
1038442095 8:27578020-27578042 GCATTCTTGGGCCGTCAATCAGG + Intergenic
1039553930 8:38463355-38463377 ACTTTCTTGGGCCTTCTAGCTGG + Intronic
1040501851 8:48011970-48011992 ACATTTTTGGCCATCCCATCTGG + Intronic
1041058661 8:54014610-54014632 ACATTGTTGGTGCTCCTATCTGG + Intronic
1041100739 8:54394440-54394462 ACAGAGTGGGGCCTTCCAACTGG + Intergenic
1042683662 8:71414085-71414107 ACTATGTAGGGCCTTCCCTCTGG - Intronic
1052229638 9:26133305-26133327 ACATTGTTTGCAGTTCCATCTGG + Intergenic
1053248605 9:36555900-36555922 ACAGTGCTGTGCATTCCATCAGG + Intergenic
1059148822 9:111928159-111928181 ACATTGTGGGAACTTGCATCTGG + Intronic
1060910908 9:127349671-127349693 ACAGTGTGGTCCCTTCCATCAGG + Intronic
1062148780 9:135006907-135006929 ACACTGCTTGGCCTTCCAGCTGG - Intergenic
1190359126 X:49632935-49632957 ACATTGCTGGGCCTTCCATCCGG - Intergenic
1192889981 X:75380049-75380071 AGAATGTTGGGCCTACCATAGGG - Intronic
1193391072 X:80929892-80929914 ACATTGTTGGGCCTTCCATCCGG + Intergenic
1194283599 X:91983087-91983109 ACATTGCTGGGCCTTCCATCCGG - Intronic
1195558958 X:106261472-106261494 ACATTGTCATGCCTTCCAGCTGG + Intergenic
1198708319 X:139473801-139473823 ACATTTTTGAGCCTGGCATCAGG + Intergenic
1200601173 Y:5207651-5207673 ACATTGCTGGGCCTTCCATCCGG - Intronic