ID: 1193393375

View in Genome Browser
Species Human (GRCh38)
Location X:80955987-80956009
Sequence ATGGTAGCCCTTATAATCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193393375_1193393378 -9 Left 1193393375 X:80955987-80956009 CCTCCGATTATAAGGGCTACCAT No data
Right 1193393378 X:80956001-80956023 GGCTACCATGAGAATTTTCAGGG No data
1193393375_1193393383 22 Left 1193393375 X:80955987-80956009 CCTCCGATTATAAGGGCTACCAT No data
Right 1193393383 X:80956032-80956054 TCAAAAGGCAGGAGCAACCCAGG No data
1193393375_1193393377 -10 Left 1193393375 X:80955987-80956009 CCTCCGATTATAAGGGCTACCAT No data
Right 1193393377 X:80956000-80956022 GGGCTACCATGAGAATTTTCAGG No data
1193393375_1193393379 -8 Left 1193393375 X:80955987-80956009 CCTCCGATTATAAGGGCTACCAT No data
Right 1193393379 X:80956002-80956024 GCTACCATGAGAATTTTCAGGGG No data
1193393375_1193393382 11 Left 1193393375 X:80955987-80956009 CCTCCGATTATAAGGGCTACCAT No data
Right 1193393382 X:80956021-80956043 GGGGAAACTATTCAAAAGGCAGG No data
1193393375_1193393381 7 Left 1193393375 X:80955987-80956009 CCTCCGATTATAAGGGCTACCAT No data
Right 1193393381 X:80956017-80956039 TTCAGGGGAAACTATTCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193393375 Original CRISPR ATGGTAGCCCTTATAATCGG AGG (reversed) Intergenic
No off target data available for this crispr