ID: 1193394396

View in Genome Browser
Species Human (GRCh38)
Location X:80967449-80967471
Sequence GAGGGTGAGCAGAAGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193394389_1193394396 28 Left 1193394389 X:80967398-80967420 CCTTTTTTCAACGTTCTTAGTTT No data
Right 1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG No data
1193394391_1193394396 1 Left 1193394391 X:80967425-80967447 CCATTAGGTTAGAACATACTCAA No data
Right 1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193394396 Original CRISPR GAGGGTGAGCAGAAGCAGGA TGG Intergenic
No off target data available for this crispr