ID: 1193394555

View in Genome Browser
Species Human (GRCh38)
Location X:80968356-80968378
Sequence GGAACTAGCCAGATGCCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193394555_1193394562 5 Left 1193394555 X:80968356-80968378 CCGGCTGGCATCTGGCTAGTTCC No data
Right 1193394562 X:80968384-80968406 GGGATGAAGCTTCCAGAGGAAGG 0: 499
1: 976
2: 1228
3: 935
4: 785
1193394555_1193394561 1 Left 1193394555 X:80968356-80968378 CCGGCTGGCATCTGGCTAGTTCC No data
Right 1193394561 X:80968380-80968402 CTCTGGGATGAAGCTTCCAGAGG 0: 539
1: 1137
2: 1561
3: 1262
4: 2768
1193394555_1193394563 11 Left 1193394555 X:80968356-80968378 CCGGCTGGCATCTGGCTAGTTCC No data
Right 1193394563 X:80968390-80968412 AAGCTTCCAGAGGAAGGAACAGG 0: 462
1: 1765
2: 1505
3: 1752
4: 1848

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193394555 Original CRISPR GGAACTAGCCAGATGCCAGC CGG (reversed) Intergenic
No off target data available for this crispr