ID: 1193408065

View in Genome Browser
Species Human (GRCh38)
Location X:81127678-81127700
Sequence GAAACACATGGGCCATCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193408062_1193408065 11 Left 1193408062 X:81127644-81127666 CCTACGAATTGTTTCGTTTTGTT 0: 1
1: 0
2: 1
3: 43
4: 510
Right 1193408065 X:81127678-81127700 GAAACACATGGGCCATCAACTGG 0: 1
1: 0
2: 2
3: 6
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193408065 Original CRISPR GAAACACATGGGCCATCAAC TGG Intronic
901254374 1:7808702-7808724 GAAACAAATGAGACATTAACAGG - Intronic
901915060 1:12492726-12492748 GAAACCCATGTGCCATCAACAGG + Intronic
902668246 1:17954210-17954232 GAAAGAAAAGGGCCATCAGCCGG + Intergenic
904952737 1:34257183-34257205 GTCAAACATGGGCCACCAACAGG + Intergenic
905545656 1:38797579-38797601 CACACTCATGTGCCATCAACAGG + Intergenic
906938904 1:50238483-50238505 GACACACATGGGCCATCAGAAGG + Intergenic
907475976 1:54705804-54705826 GATACACATAGGTCGTCAACAGG + Intronic
908139989 1:61174256-61174278 GAAACACATGCGCTCTCAGCAGG + Intronic
909486900 1:76184563-76184585 GAAACATATGGGCAATCCAGGGG + Intronic
910036948 1:82800244-82800266 GAAAAACTGTGGCCATCAACAGG - Intergenic
910790627 1:91046149-91046171 CAATCACATGGTCCAACAACAGG - Intergenic
913444066 1:118931156-118931178 AAAACACAATGGACATCAACAGG + Intronic
915267477 1:154729269-154729291 GAACCACAGGGGACATCAACTGG + Intronic
1066997235 10:42575479-42575501 AAATCACATGGACCATAAACTGG - Intronic
1067867263 10:49922290-49922312 GAGACACAGGGCCCATAAACAGG + Intronic
1073332154 10:102677334-102677356 TAAACACATGGGGCACCAAAAGG - Intronic
1073687718 10:105774373-105774395 GAAACAGATGAACCATCAAAGGG - Intergenic
1074006670 10:109432672-109432694 GATAAACCTGGGGCATCAACTGG + Intergenic
1075975297 10:126689262-126689284 CAAATAAATGGGCCATCATCAGG + Intergenic
1077871420 11:6265385-6265407 CACACACATGGGACATCAGCTGG + Intronic
1080575066 11:33591263-33591285 GCAACACCTGGGCCAGCAAGGGG + Exonic
1082021867 11:47540929-47540951 GAAACACCTGTGCCATTTACTGG - Intronic
1082693245 11:56330236-56330258 GAAAAACATGGGATATCACCTGG - Intergenic
1085610824 11:77947149-77947171 GGAACATATGGGACATCAACAGG + Intronic
1086061399 11:82703293-82703315 GAGACACACAGGCCATCAAATGG - Intergenic
1086607204 11:88709961-88709983 GAACCAAAGGGGCCTTCAACAGG - Intronic
1088040090 11:105370596-105370618 GAAACAAACTGTCCATCAACAGG + Intergenic
1088235510 11:107718850-107718872 GATACACAAGGGTCAGCAACAGG + Intronic
1090598341 11:128343173-128343195 TAAACACATGGGCCAGCCACAGG + Intergenic
1092383920 12:8020923-8020945 CAAACACAAAAGCCATCAACTGG + Intergenic
1098086180 12:66846801-66846823 GAAACACCTGGGTCAGCCACGGG + Intergenic
1100287067 12:93177132-93177154 GAAAACCAAGGGCAATCAACAGG + Intergenic
1113796451 13:113061439-113061461 GAGACATATGGGCCAGCACCAGG + Intronic
1115491939 14:33966188-33966210 GGAAGACATGAGCCATCAATCGG + Intronic
1115897412 14:38105522-38105544 TAACCAGATGGGCCAACAACAGG + Intergenic
1116140557 14:40988230-40988252 CCAACACCTGGGCCATGAACTGG - Intergenic
1117174119 14:53130376-53130398 TTAACAAATGGGCCATGAACTGG - Intronic
1121501549 14:94442245-94442267 AAAACACAGGGGGCATCAGCAGG - Intergenic
1129082846 15:73055734-73055756 GAGACACAGGGGCCAGGAACTGG - Intronic
1133780618 16:8936241-8936263 GATACGCATGGGCCAACACCTGG + Intronic
1137048700 16:35690593-35690615 GAAACCCATGGGCGACCCACAGG - Intergenic
1138104507 16:54280587-54280609 AGAACACATGAGCCCTCAACTGG - Intergenic
1139389641 16:66598809-66598831 GAAACCAAATGGCCATCAACAGG - Intergenic
1141374467 16:83517615-83517637 GGAACACGTGGGCAATCACCAGG + Intronic
1143228886 17:5334012-5334034 GAAATTAATGGGCAATCAACAGG + Intronic
1143687710 17:8532286-8532308 GAAAGACAAGGGCCATAAATAGG + Intronic
1144754866 17:17673246-17673268 GAACCACATGGGCCATAAGTGGG + Intergenic
1146188812 17:30747131-30747153 GAAAAACATGGGCTATTAAATGG + Intergenic
1157751487 18:50182699-50182721 GAAACAGATGGGCTTTCTACTGG + Intronic
1158511541 18:58094930-58094952 TAAACTCATAGGCCATGAACAGG - Intronic
1159240208 18:65732595-65732617 GAAGCTCATGGTCCATCAATAGG - Intergenic
1164039600 19:21483358-21483380 GACACACATGGGCCCGCAACCGG - Intronic
928631291 2:33194983-33195005 CAAACACATGTGCCGTCATCCGG - Intronic
932480297 2:72035122-72035144 GAAACTCATAGACCATCAAGAGG - Intergenic
935739033 2:106130529-106130551 GAAACACATCCACCATCCACAGG + Intronic
938933874 2:136111749-136111771 TAAACACAATGGTCATCAACCGG - Intergenic
941139619 2:161763362-161763384 GAAACACATGGTCACTCAAAAGG + Intronic
943715923 2:191151753-191151775 GAAACACCTGGGCTATTATCGGG - Intergenic
945442877 2:209901373-209901395 GAAACAGATGGGCTGTCATCCGG - Intronic
947556225 2:231095777-231095799 GCAACCCATGGGGCCTCAACAGG - Intronic
1170597575 20:17817294-17817316 CAAACAAATGGGCAAGCAACAGG + Intergenic
1171391676 20:24805463-24805485 GAGCCACCTGGCCCATCAACAGG + Intergenic
1172446448 20:34995937-34995959 GAACCACAGGGGCCATCACGAGG - Intronic
1177604808 21:23364083-23364105 GCATCACATGGGCTAACAACTGG - Intergenic
1179141065 21:38725875-38725897 GAAACACATGAGACCTCAAAAGG - Intergenic
1180159893 21:45994324-45994346 GAAACACAGAGGCCCTCAAACGG - Intronic
1182690530 22:32158643-32158665 GAAACAATTGGGCCCTTAACTGG + Intronic
959202708 3:103269409-103269431 GAAATTCATGAACCATCAACAGG - Intergenic
960675203 3:120186723-120186745 GGATCACATCAGCCATCAACAGG + Exonic
961311660 3:126005885-126005907 GAAAGACATGGTACATTAACTGG - Intergenic
965707658 3:171525342-171525364 CAAACACATGGACTATCAATAGG + Intergenic
967933026 3:194704158-194704180 GAAACAGATGGCCTATCCACAGG - Intergenic
971151441 4:24036481-24036503 GAAACAAAATGTCCATCAACAGG + Intergenic
972429406 4:38966052-38966074 GTAACACAAGGGCCATCCTCAGG + Intergenic
982069680 4:151684210-151684232 GAAACACTGGGGCACTCAACTGG + Intronic
982628667 4:157803117-157803139 GAAAAACATGACCCATAAACGGG - Intergenic
984415511 4:179452992-179453014 GAAAAACATGGCCCATCTAAAGG + Intergenic
984532946 4:180940015-180940037 GAAACACCTGTGACACCAACTGG - Intergenic
987177544 5:15330889-15330911 GAAACCCAATTGCCATCAACTGG + Intergenic
987896876 5:23957965-23957987 GAAACATAGAGGCCATCAAGAGG + Intronic
991390339 5:66136436-66136458 GGATCACATGGTCTATCAACAGG - Intergenic
1000147103 5:158464166-158464188 GAAACACATGGGCCCCCGAACGG - Intergenic
1001316496 5:170644673-170644695 GAAACAAATGGGCCATCAGCAGG + Intronic
1003129754 6:3385765-3385787 CAAACACATGTGCCTGCAACTGG + Intronic
1013431024 6:110054901-110054923 GAACCCCAGGGGCCATCAGCTGG + Intergenic
1015021402 6:128480192-128480214 GAAACCCAGGAGCCATCACCAGG + Intronic
1015869271 6:137759692-137759714 ACAACACAGTGGCCATCAACGGG + Intergenic
1016725921 6:147366972-147366994 GAAAAACATGAGCCATCATGAGG + Intronic
1017168437 6:151432470-151432492 GAAACACATGGACCATCTGTAGG - Intronic
1020510302 7:9048255-9048277 GCAAAACATGAGCAATCAACTGG + Intergenic
1021052458 7:16005012-16005034 GAAACACATGTGCCTTTAAGAGG - Intergenic
1022688439 7:32619485-32619507 AAAACACATGGACCATTAAATGG - Intergenic
1022916023 7:34953788-34953810 AAAACACATGGACCATTAAATGG - Intronic
1023780312 7:43648956-43648978 CAAACACAGGGCCAATCAACAGG + Exonic
1025842280 7:65161902-65161924 GGAACATATGGGACATCAATAGG - Intergenic
1025880767 7:65534066-65534088 GGAACATATGGGACATCAATAGG + Intergenic
1025892670 7:65668540-65668562 GGAACATATGGGACATCAATAGG - Intergenic
1026402635 7:70030682-70030704 CAATGACATGGGCCATAAACTGG - Intronic
1034447017 7:151118917-151118939 GAAAGTCCTGGGCCATCCACAGG + Intronic
1036194088 8:6699037-6699059 GACACACTGGGACCATCAACTGG + Intergenic
1043606641 8:82008558-82008580 GAATCACATGGGTCATTAAAAGG + Intergenic
1047494920 8:125402635-125402657 GAAACACAGGGGTCATTACCTGG - Intergenic
1047858650 8:128939991-128940013 GAAACAGATGTGCCTTCAAAGGG - Intergenic
1049924095 9:392274-392296 GAAACAAATGAACCATCCACTGG + Intronic
1053478297 9:38397522-38397544 GCAACTCATGGGCCACCAAGGGG - Exonic
1185558589 X:1040791-1040813 GAAACAAAAAGGCCATCAAAGGG - Intergenic
1185806920 X:3066475-3066497 GCAACACAAGGGACATCAAATGG + Intronic
1186792733 X:13014864-13014886 GAAACAGATGAGTCATCAAAGGG + Intergenic
1187851417 X:23594994-23595016 TAGTCACATGGGCCATGAACAGG + Intergenic
1187962036 X:24575771-24575793 GAAATAAGTGGGCCATTAACTGG + Intronic
1188563923 X:31503452-31503474 GAAAGACATGGGCCAGCAGCTGG - Intronic
1190722438 X:53161173-53161195 GAAAGACATGGGATATCAAAGGG - Intergenic
1193408065 X:81127678-81127700 GAAACACATGGGCCATCAACTGG + Intronic
1195468495 X:105208075-105208097 GTAAAACATGGGCCATGCACAGG + Intronic