ID: 1193415442

View in Genome Browser
Species Human (GRCh38)
Location X:81216945-81216967
Sequence ATATGTACCCAGCAGTAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193415439_1193415442 -9 Left 1193415439 X:81216931-81216953 CCATTTTCTTTTGGATATGTACC 0: 2
1: 2
2: 7
3: 29
4: 413
Right 1193415442 X:81216945-81216967 ATATGTACCCAGCAGTAGGGTGG 0: 1
1: 0
2: 1
3: 17
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193415442 Original CRISPR ATATGTACCCAGCAGTAGGG TGG Intronic
900696925 1:4018027-4018049 ATATGGACTCAGCAGCATGGTGG + Intergenic
903649520 1:24914346-24914368 CTGTCTACCCAGCAGCAGGGTGG + Intronic
905536406 1:38725673-38725695 AACTGGACACAGCAGTAGGGTGG + Intergenic
907195626 1:52684284-52684306 ATATGTACCCAGAAGTGGAATGG + Intergenic
907226223 1:52949540-52949562 AACTGGACACAGCAGTAGGGTGG - Intronic
910636355 1:89413086-89413108 ATATATACCCAGTAGTGGGATGG + Intergenic
911032540 1:93505369-93505391 AACTGGACACAGCAGTAGGGTGG - Intronic
911373289 1:97020173-97020195 ATATATACCCAGTAGTGGGATGG - Intergenic
911934147 1:103945574-103945596 GAATGTACCCAGCAGGAGGCTGG + Intergenic
912438992 1:109684046-109684068 AACTGGACACAGCAGTAGGGTGG + Intronic
912441514 1:109702491-109702513 AACTGGACACAGCAGTAGGGTGG + Intronic
915809480 1:158891602-158891624 ATATATACCCAGTAGTGGGATGG - Intergenic
916028240 1:160854028-160854050 TTATGGACCCAGCAGTAGCATGG + Intronic
916541871 1:165764677-165764699 AGATGTAGCCAGGAGAAGGGAGG + Intronic
918966964 1:191363377-191363399 GTATGTATCCAGGAGTAGGTAGG + Intergenic
919191338 1:194223880-194223902 ATATATACCCAGTAGTAGAATGG - Intergenic
921892719 1:220369151-220369173 ATATGTAGCCAGCAACAGAGAGG - Intergenic
922238661 1:223740412-223740434 AACTGGACACAGCAGTAGGGTGG - Intronic
922976703 1:229790841-229790863 AACTGGACACAGCAGTAGGGTGG + Intergenic
923309196 1:232719211-232719233 AACTGGACACAGCAGTAGGGTGG - Intergenic
1065629834 10:27667475-27667497 GTATGTACCCAGTAATAGGATGG - Intergenic
1065811223 10:29445611-29445633 ATATGTCCCCAGCAGAGGGCAGG + Intergenic
1065908792 10:30283424-30283446 ATATGTCCCCAACAGAAGGCAGG + Intergenic
1065955303 10:30688627-30688649 ATATTTACCGAGAAGCAGGGTGG - Intergenic
1068854873 10:61787235-61787257 ATATGTTCCCAGTCGTGGGGGGG + Intergenic
1069213622 10:65792372-65792394 AACTGGACACAGCAGTAGGGTGG - Intergenic
1069450826 10:68516246-68516268 AACTGGACACAGCAGTAGGGTGG - Intronic
1069724724 10:70569791-70569813 ATGTGTACCCAGGAGTGGGATGG - Intergenic
1070058814 10:72961289-72961311 GTATATACCCAGCAGTGGGATGG + Intergenic
1070772087 10:79088435-79088457 ATGTTTACCCAGCAGAAGGGTGG - Intronic
1071605544 10:86984854-86984876 GTATATACCCAGTAGTAGGATGG + Intergenic
1071790354 10:88947168-88947190 TTATTTCCCCAGCAGTAGTGTGG + Intronic
1072349983 10:94547169-94547191 ATATGAATCAAGCAGCAGGGTGG - Intronic
1073922073 10:108470709-108470731 CTATGAAAGCAGCAGTAGGGGGG - Intergenic
1074538268 10:114344551-114344573 ATATGTACCAAGCCAAAGGGTGG + Intronic
1078532339 11:12146697-12146719 GTATATACCCAGCAATAGGATGG - Intronic
1078940150 11:15994051-15994073 ATATGTACCCAGCATTGTGATGG + Intronic
1079898112 11:26148375-26148397 AAAGGTGGCCAGCAGTAGGGGGG - Intergenic
1080005121 11:27398528-27398550 ATATGGACTGAGCAGCAGGGAGG + Intronic
1082749527 11:57001586-57001608 AAAGGTTGCCAGCAGTAGGGAGG - Intergenic
1084048189 11:66582806-66582828 AATTGGACACAGCAGTAGGGTGG - Intergenic
1085671953 11:78475411-78475433 ATATGTACCCAGAGGTAGGATGG + Intronic
1086474307 11:87154482-87154504 ATATATACCCAGAAGCAGGGTGG + Intronic
1088049180 11:105490486-105490508 ATATGGCCACAGCAGTAGAGAGG + Intergenic
1089649788 11:119905300-119905322 TTAAGTACCCAGCAGTGGGTGGG - Intergenic
1092958108 12:13569006-13569028 TTATGTGCCCAGAGGTAGGGCGG - Intronic
1093347878 12:18062506-18062528 ATATATACCCAGAAGTGGTGTGG - Intergenic
1093969602 12:25362885-25362907 ATATGTTCCCAGCAGTTCTGAGG + Intergenic
1094477122 12:30849703-30849725 AACTGGACACAGCAGTAGGGTGG - Intergenic
1095134254 12:38579319-38579341 ATATATACCCAGCAGTAGAATGG - Intergenic
1095463759 12:42469079-42469101 AAATGTATCCAGCAGGAGGCTGG - Intronic
1097062045 12:56292476-56292498 AACTGGACACAGCAGTAGGGTGG + Intronic
1098636274 12:72787767-72787789 ATATGGACTCCCCAGTAGGGAGG + Intergenic
1099850085 12:88082886-88082908 ATATGTAACCAGCAGTCCTGAGG + Intronic
1100917938 12:99448084-99448106 ATATATACCCAGCAGTGGGATGG - Intronic
1102478811 12:113206495-113206517 AACTGGACACAGCAGTAGGGTGG + Intronic
1103640680 12:122349361-122349383 ATATAGACCCATCAGTAAGGAGG - Intronic
1106179122 13:27356013-27356035 AAATCTGCCCAGCAGTAGGTGGG - Intergenic
1107503585 13:41007156-41007178 ATCTGTACTCTGCAGCAGGGAGG - Intronic
1111140228 13:84107983-84108005 ATATATACCCAATAGTAGGTGGG - Intergenic
1111424127 13:88057457-88057479 ATATATACCCAGTAGTGGGGTGG + Intergenic
1111600935 13:90473108-90473130 GTATGTACCCAGTAATAGGATGG + Intergenic
1118492753 14:66277551-66277573 ATATATACTCAGAAGTTGGGGGG - Intergenic
1121083159 14:91125109-91125131 AACTGGACACAGCAGTAGGGTGG + Intronic
1122755581 14:103976681-103976703 AAATATACCCAGTAGTAGGATGG + Intronic
1123838063 15:24216434-24216456 AACTGGACACAGCAGTAGGGTGG + Intergenic
1126269517 15:46798304-46798326 ATATATACCTAGCAGTGGGATGG - Intergenic
1127950002 15:63795765-63795787 AACTGGACACAGCAGTAGGGTGG - Intronic
1128400071 15:67269991-67270013 ATATATACCCAGTAGTGGGATGG + Intronic
1128825108 15:70707906-70707928 ATATATACCCAGAAGTAGGATGG - Intronic
1129727961 15:77911207-77911229 ATATGTACACTGCGGAAGGGGGG + Intergenic
1134583628 16:15393036-15393058 GTATATACCCAGCAATAGGATGG - Intergenic
1135923883 16:26675295-26675317 GTATGAACCCAGGAATAGGGAGG - Intergenic
1136192650 16:28626329-28626351 GTATATACCCAGCAATAGGATGG + Intergenic
1136840067 16:33530524-33530546 GTATATACCCAGCAGTGGGATGG - Intergenic
1137039841 16:35600303-35600325 AACTGGACACAGCAGTAGGGTGG - Intergenic
1138966517 16:62091035-62091057 GTATGTACCCAGCAATGGGATGG - Intergenic
1142441311 16:90099688-90099710 AACTGGACACAGCAGTAGGGTGG + Intergenic
1203150234 16_KI270728v1_random:1830809-1830831 GTATATACCCAGCAGTGGGATGG - Intergenic
1143877450 17:10002916-10002938 GTATATACCCAGCAATAGGATGG + Intronic
1143953722 17:10653287-10653309 ATATGTCCCCTGCAGTCGTGAGG + Intronic
1151324009 17:73367950-73367972 ATCTGTCCCCCGCACTAGGGTGG + Intronic
1151626821 17:75281781-75281803 ATAATTACCCAGCAGTGGGCTGG - Intronic
1153781406 18:8498122-8498144 GTATATACCCAGTAGTAGGATGG + Intergenic
1154127558 18:11705462-11705484 ATATATACCCAGAAGTGGGATGG + Intronic
1156146913 18:34193717-34193739 ATATATACCCAGTAGTAGGATGG - Intronic
1156470929 18:37376895-37376917 AGGTGTACCCAGAGGTAGGGAGG - Intronic
1157731978 18:50011782-50011804 ATATGTTTCCAGCAGCAGTGAGG - Intronic
1157903834 18:51547712-51547734 ATATATACCCAGCAGTGGGATGG + Intergenic
1158590773 18:58777012-58777034 CTATGTACCCAGCAGCCTGGAGG + Intergenic
1158785371 18:60705622-60705644 TTGTGTACTAAGCAGTAGGGAGG + Intergenic
1161718673 19:5891732-5891754 ATGTGTACCCAGCGGGAGGCTGG - Exonic
1162226416 19:9226353-9226375 AACCGGACCCAGCAGTAGGGTGG - Intergenic
1162265960 19:9574562-9574584 AACTGGACACAGCAGTAGGGTGG - Intronic
1163210685 19:15837513-15837535 AACTGGACACAGCAGTAGGGTGG - Intergenic
1163976478 19:20857948-20857970 AACTGGACACAGCAGTAGGGTGG + Intronic
1165294739 19:34917431-34917453 AACTGGACACAGCAGTAGGGTGG - Intergenic
1166951822 19:46433853-46433875 GTATATACCCAGCAGTGGGATGG + Intergenic
925797275 2:7559969-7559991 ATATATACCCAGGAGTGGGATGG - Intergenic
931561696 2:63568616-63568638 AACTGGACACAGCAGTAGGGTGG - Intronic
937518117 2:122678869-122678891 ATATGTAGCTACCAGTAGGAGGG + Intergenic
937726594 2:125174531-125174553 AACTGGACACAGCAGTAGGGTGG + Intergenic
939505132 2:143036322-143036344 AACTGGACACAGCAGTAGGGTGG - Intronic
939545437 2:143546570-143546592 AGATCTACACAGCAGTGGGGTGG - Intronic
941912606 2:170779260-170779282 CTATGAAGCCAGCAGCAGGGTGG - Intergenic
942354965 2:175100849-175100871 AACTGGACACAGCAGTAGGGTGG + Intronic
944570348 2:201038378-201038400 GTATATACCCAGCAATAGGATGG - Intronic
944591784 2:201224587-201224609 ATATGTATGCAGAAGTGGGGAGG - Intronic
1169319469 20:4619526-4619548 ATATGTACCCAGTAATGGGAGGG + Intergenic
1170390997 20:15874420-15874442 GTATATACCCAGTAGTGGGGTGG + Intronic
1170401950 20:15996012-15996034 ATATGTAACCAGAAGTGGGATGG + Intronic
1173235446 20:41241021-41241043 GTATATACCCAGCAGTGGGATGG + Intronic
1175601931 20:60281337-60281359 AGATGTTTCCAGCAGGAGGGTGG - Intergenic
1177578457 21:22988820-22988842 GTATATACCCAGCAGTTTGGGGG - Intergenic
1181176958 22:21043382-21043404 GTGTGCACCAAGCAGTAGGGAGG + Intergenic
1183943052 22:41307230-41307252 CTATAATCCCAGCAGTAGGGAGG - Intronic
1184485689 22:44777550-44777572 ATGGGTAACGAGCAGTAGGGAGG - Intronic
949778330 3:7656617-7656639 TTATGTCCCCAGGGGTAGGGAGG + Intronic
950342411 3:12258991-12259013 ATATGTACCCAGCAGTGGGATGG - Intergenic
951177370 3:19617676-19617698 TTATATACCCAGCAGTGGGATGG + Intergenic
951709139 3:25571837-25571859 ATATCTACCCAGCAGTGGAGTGG + Intronic
952991318 3:38833402-38833424 GTATATACCCAGCAATAGGATGG - Intergenic
955476349 3:59340332-59340354 ATCTGTAGCCAGCAGGAGCGAGG + Intergenic
955512064 3:59691242-59691264 ATATGTATCCTGGAGTGGGGAGG + Intergenic
957802028 3:85097505-85097527 GTATGTACCCAGCAATGGGATGG + Intronic
957836236 3:85594045-85594067 ATATGTAACCAGCAATAGCCAGG - Intronic
959165271 3:102769026-102769048 GTATATACCCTGTAGTAGGGTGG + Intergenic
965075151 3:163966057-163966079 ATATATACCCAGTAATTGGGGGG - Intergenic
966336407 3:178872810-178872832 GTATGTATCCAGCACTAGGCAGG + Intergenic
967373068 3:188770515-188770537 ATAATTACCCAGCTGTAGCGTGG + Intronic
968361568 3:198150664-198150686 AACTGGACACAGCAGTAGGGTGG + Intergenic
968980439 4:3846127-3846149 ATATGTGCCAAGCAGTGGGCTGG + Intergenic
969517379 4:7655096-7655118 ATATGGCCCCAGCAGGAGAGAGG - Intronic
970105229 4:12575157-12575179 ATATGGACCCTGCAGAAAGGAGG + Intergenic
970176294 4:13342724-13342746 ATGTGTTCGCATCAGTAGGGTGG + Intergenic
970600705 4:17639192-17639214 AAATGTACCATTCAGTAGGGTGG - Intronic
976974404 4:91148990-91149012 GTATATACCCAGCAGTGGGATGG + Intronic
977988342 4:103412642-103412664 AACTGGACACAGCAGTAGGGTGG - Intergenic
978702537 4:111665830-111665852 ATATATACTCAGCATTAGAGTGG - Intergenic
979594424 4:122518527-122518549 ATGTATACCCAGCAGTAGGATGG + Intergenic
979888781 4:126064047-126064069 AACTGGACACAGCAGTAGGGTGG - Intergenic
981284235 4:142996520-142996542 ATATATATCCAGCAATAGGATGG - Intergenic
981442992 4:144804415-144804437 GTATGTACCCAGCAATGGGATGG + Intergenic
981625814 4:146753537-146753559 ATATATATCCAGCAATAGGATGG - Intronic
985751238 5:1677500-1677522 ATAAATACCCAGTAGTAGGGTGG + Intergenic
988215963 5:28273526-28273548 ATATATACCCTGTAGTAGGATGG + Intergenic
988442050 5:31244487-31244509 ATGTGTTCCCTGCAGTTGGGAGG + Intronic
988846088 5:35129784-35129806 AAAAGTGCCAAGCAGTAGGGTGG + Intronic
989434947 5:41400322-41400344 GTATATACCCAGCAGTGGGATGG - Intronic
990153433 5:52846791-52846813 ATGTGTACCCAGGATTTGGGAGG - Intronic
990656892 5:57967089-57967111 ATATATACCCAGTAATAGGATGG + Intergenic
993179342 5:84531046-84531068 ATATATACTCAGCAGTGGGATGG - Intergenic
993420435 5:87694744-87694766 GTATGTACCCAGCAATGGGATGG + Intergenic
994869837 5:105333697-105333719 ATATACACCCAGCAGTGGGATGG + Intergenic
995515756 5:112953961-112953983 CTATGGTCCCAGCTGTAGGGGGG - Intergenic
995791453 5:115892291-115892313 ATATATACCCAGCAGTGAGCTGG - Intronic
996713486 5:126567232-126567254 AACTGGACACAGCAGTAGGGTGG + Intronic
999833855 5:155347977-155347999 AACTGGACACAGCAGTAGGGTGG + Intergenic
999939417 5:156525078-156525100 ATATGTACCCAGAAGTGGGATGG + Intronic
1000327952 5:160186563-160186585 AACTGGACACAGCAGTAGGGTGG + Intergenic
1002378937 5:178811056-178811078 ATGTATACCCAGCAGTAGCATGG - Intergenic
1004050567 6:12073965-12073987 TTTTGTTCCCAGCAGTAGTGAGG - Intronic
1004582492 6:16967549-16967571 ATTTGAACCCAGGATTAGGGAGG - Intergenic
1006481897 6:34301858-34301880 ATATTGACCCAGAAGTGGGGAGG - Intronic
1006974620 6:38087817-38087839 CTATGTACCCAGCAGTGGAATGG - Intronic
1008132585 6:47735738-47735760 ATATATACCCAGAAGTTGGATGG - Intergenic
1009877476 6:69522934-69522956 GTATATACCCAGTAGTAGGATGG - Intergenic
1011063700 6:83300682-83300704 ATATGTACCCAGTAATGGGATGG - Intronic
1011249570 6:85356788-85356810 ATATATACCCAGTAATAGGATGG - Intergenic
1011348543 6:86398215-86398237 ATATGTACCCAGTAATGGGATGG - Intergenic
1013756583 6:113469129-113469151 GTATATACCCAGCAATAGGATGG - Intergenic
1019254117 7:38056-38078 AACTGGACACAGCAGTAGGGTGG - Intergenic
1020472747 7:8557598-8557620 TAATGTACCCAGCAGTAATGGGG + Intronic
1020706596 7:11551828-11551850 GTATATACCCAGTAGTAGGATGG - Intronic
1021309660 7:19078251-19078273 ATAAATACCCAGTAGTAGGATGG - Intronic
1021716511 7:23467850-23467872 AAATGTACCCAGGAGGAGTGGGG + Intronic
1030207836 7:106967815-106967837 AACTGGACACAGCAGTAGGGTGG + Intergenic
1030892180 7:115012558-115012580 CTAAGTAACCAGCAGTAGGATGG - Intronic
1032119170 7:129144421-129144443 ATATGTGCACAGCAGCTGGGCGG + Intergenic
1032331162 7:130981454-130981476 ATATATACCCAGTAGTGGGATGG - Intergenic
1036101017 8:5785222-5785244 ATGTGTACCCAGAAGTGGGATGG + Intergenic
1036727334 8:11231582-11231604 AAATGTCCCCAGCAGTGGGGAGG + Intergenic
1038525087 8:28266198-28266220 AACTGGACACAGCAGTAGGGCGG - Intergenic
1039699513 8:39947628-39947650 AACTGGACACAGCAGTAGGGTGG + Intronic
1040632772 8:49235396-49235418 GTATATACCCAGCAGTGGGTTGG + Intergenic
1042602021 8:70508041-70508063 GTATGTACCCAGCAATGGGATGG + Intergenic
1045072946 8:98529560-98529582 ATATATACCCAGAAGTAAGATGG - Intronic
1045637268 8:104206806-104206828 ATATGTCCCAAGGAGTAGGGAGG + Intronic
1045708775 8:104959192-104959214 ATATATACCCAGTAGTGGGATGG + Intronic
1046796132 8:118374487-118374509 ATATGTACCCAGAAGTGAGATGG + Intronic
1049333299 8:142067242-142067264 ATAGATACCCAGCAGTGGGATGG - Intergenic
1050522398 9:6514867-6514889 GTATATACCCAGCAGTGGGATGG + Intergenic
1050863658 9:10469643-10469665 ATATATACTCAGCAGTAGAATGG - Intronic
1051473927 9:17481535-17481557 AGATGTACGCTGCAGTTGGGTGG - Intronic
1052210477 9:25897025-25897047 ATAGGTAACCAGCAGAAGAGGGG + Intergenic
1054986846 9:71271564-71271586 ATTTCTACCCAGCAGAAGAGGGG + Intronic
1057615117 9:96582536-96582558 AACTGGACACAGCAGTAGGGTGG + Intronic
1058299918 9:103359004-103359026 ATATGGACCCAGAAGTGGGGAGG - Intergenic
1058919931 9:109603692-109603714 ATATGGATCCATCAGAAGGGAGG - Intergenic
1059412780 9:114143620-114143642 ATATGCAGCCTGCAGTGGGGTGG + Intergenic
1061470096 9:130817549-130817571 AACTGGACACAGCAGTAGGGTGG + Intronic
1062746286 9:138214485-138214507 AACTGGACACAGCAGTAGGGTGG + Intergenic
1185703805 X:2251553-2251575 AACTGGACACAGCAGTAGGGCGG + Intronic
1185849928 X:3475779-3475801 ATCTGTACCCAGAAGTGGGATGG - Intergenic
1187077287 X:15947779-15947801 AAGTGTAGCCAGCAGCAGGGTGG + Intergenic
1187632058 X:21184103-21184125 ATATATACCCAGCAGTGAGATGG + Intergenic
1187717356 X:22115963-22115985 ATATATACCCAGTAGTGGGATGG + Intronic
1188157477 X:26757227-26757249 AACTGGACACAGCAGTAGGGTGG + Intergenic
1188826620 X:34842692-34842714 ATATATACCCAGAAGTGGGATGG - Intergenic
1188968881 X:36588633-36588655 GTATATACCCAGCAGTTGGATGG + Intergenic
1189964628 X:46359940-46359962 AACTGGACACAGCAGTAGGGTGG - Intergenic
1190961138 X:55249310-55249332 GTATATACCCAGCAGTGGGGTGG - Intronic
1191846953 X:65554012-65554034 AACTGGACACAGCAGTAGGGTGG + Intergenic
1192093108 X:68182057-68182079 ATATGTACCCACCAGTCGTCCGG - Intronic
1192188654 X:68977018-68977040 ATATCTACCCAGTAGTAAAGAGG - Intergenic
1192573975 X:72228143-72228165 AACTGGACACAGCAGTAGGGTGG + Intronic
1192799373 X:74451149-74451171 ATATGTAACCAGTAGAAAGGTGG + Intronic
1193105105 X:77662291-77662313 ACATGTTTCCAGCAGTATGGTGG - Intronic
1193415442 X:81216945-81216967 ATATGTACCCAGCAGTAGGGTGG + Intronic
1195775536 X:108400163-108400185 ATATTTGCCCAGCAGTAAAGAGG - Intronic
1195911640 X:109894138-109894160 GTATATACCCAGCAGTGGGATGG + Intergenic
1196344025 X:114630902-114630924 ATATGTACCCAGCTGCATGCAGG - Intronic
1197912317 X:131496673-131496695 GCATATACCCAGCAGTGGGGTGG + Intergenic
1198853687 X:140993302-140993324 ATTTGTGCCCAGGGGTAGGGGGG - Intergenic
1199151704 X:144494673-144494695 AACTGGACACAGCAGTAGGGCGG - Intergenic
1200733792 Y:6772239-6772261 ATATGTACCCAGTAGTCGTTCGG + Intergenic
1201668959 Y:16493489-16493511 AACTGGACACAGCAGTAGGGTGG + Intergenic
1201936190 Y:19413166-19413188 ATATATACCCAGTAATAGGATGG + Intergenic