ID: 1193418834

View in Genome Browser
Species Human (GRCh38)
Location X:81258637-81258659
Sequence TGGCCATGGGCCATTTCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193418826_1193418834 30 Left 1193418826 X:81258584-81258606 CCTAAATCAAGGTGTTTTGGTTG No data
Right 1193418834 X:81258637-81258659 TGGCCATGGGCCATTTCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193418834 Original CRISPR TGGCCATGGGCCATTTCTAA GGG Intronic