ID: 1193423148

View in Genome Browser
Species Human (GRCh38)
Location X:81308435-81308457
Sequence GCTCCCATGGTGAAGTGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193423142_1193423148 14 Left 1193423142 X:81308398-81308420 CCCTCTGGTTGAGCAGTGGTGGC No data
Right 1193423148 X:81308435-81308457 GCTCCCATGGTGAAGTGGACAGG No data
1193423139_1193423148 24 Left 1193423139 X:81308388-81308410 CCTGCAAAAGCCCTCTGGTTGAG No data
Right 1193423148 X:81308435-81308457 GCTCCCATGGTGAAGTGGACAGG No data
1193423143_1193423148 13 Left 1193423143 X:81308399-81308421 CCTCTGGTTGAGCAGTGGTGGCT No data
Right 1193423148 X:81308435-81308457 GCTCCCATGGTGAAGTGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193423148 Original CRISPR GCTCCCATGGTGAAGTGGAC AGG Intergenic
No off target data available for this crispr