ID: 1193426646

View in Genome Browser
Species Human (GRCh38)
Location X:81347977-81347999
Sequence CTGAATATAGAGACAGACGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193426645_1193426646 -8 Left 1193426645 X:81347962-81347984 CCTGGAGTGGAGAAACTGAATAT No data
Right 1193426646 X:81347977-81347999 CTGAATATAGAGACAGACGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193426646 Original CRISPR CTGAATATAGAGACAGACGA TGG Intergenic
No off target data available for this crispr