ID: 1193427959

View in Genome Browser
Species Human (GRCh38)
Location X:81363515-81363537
Sequence GCAAAGGTATTACCTCTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193427959 Original CRISPR GCAAAGGTATTACCTCTTCC AGG Intergenic
902518789 1:17004381-17004403 GCTGCGGTATTACCTCTTCCAGG - Exonic
905283400 1:36863656-36863678 GCTCAAGTATCACCTCTTCCAGG + Intronic
905755022 1:40501863-40501885 GTAGAGGTAGTACCACTTCCTGG - Intergenic
907207714 1:52788765-52788787 GCAAAGATATTACCTCATTGAGG - Intronic
907385916 1:54125236-54125258 GCCCAGGCATCACCTCTTCCAGG + Intergenic
907650458 1:56289717-56289739 GCCCAGGTGTCACCTCTTCCAGG - Intergenic
909055865 1:70820442-70820464 ACTAAGGTGTTACTTCTTCCAGG - Intergenic
910780246 1:90924217-90924239 GCAAACGTATTACTTCTTTGTGG + Intronic
911947454 1:104130668-104130690 GCAAAGGCATTGCCTTTTCCAGG - Intergenic
915279791 1:154814546-154814568 GCATAGATATTTCCTCCTCCAGG - Intronic
916068446 1:161155216-161155238 GCTCAAGCATTACCTCTTCCAGG - Intronic
916172615 1:162011981-162012003 GCCAATATATTACCTCTCCCAGG - Intronic
916989133 1:170223369-170223391 GCTCAGGTATAACCACTTCCTGG + Intergenic
917205786 1:172571026-172571048 GCTCAGGAATTACCTCTTCCAGG - Intronic
917249531 1:173042819-173042841 GTAAAAATGTTACCTCTTCCAGG - Intronic
918361201 1:183759867-183759889 GCTCAAGTATCACCTCTTCCAGG + Intronic
920647871 1:207816493-207816515 GCAGAGCTATTAGCCCTTCCTGG + Intergenic
923277553 1:232411314-232411336 GGAATGTTATTACCTCTCCCTGG - Intronic
923430651 1:233917017-233917039 GCAAATGTATTAGCTCCTCAGGG + Intronic
923498954 1:234548863-234548885 CTTAAGGGATTACCTCTTCCAGG - Intergenic
1066498030 10:35961310-35961332 GGAAAGGTATGACCTCTTTTGGG + Intergenic
1071688979 10:87795296-87795318 GCAATTGTATAACTTCTTCCTGG - Intronic
1073977162 10:109115129-109115151 ACAAACATATGACCTCTTCCCGG - Intergenic
1074380432 10:112975037-112975059 GAAATGGCATTACCTGTTCCCGG + Intronic
1076471695 10:130723574-130723596 GCAAAGGTCTTATTTCTTCATGG + Intergenic
1076502246 10:130946480-130946502 GCGCAGGTACAACCTCTTCCAGG - Intergenic
1078884361 11:15485222-15485244 TTAAAGGTATTAGCTCTTCCAGG - Intergenic
1079572915 11:21966919-21966941 TCAAAGGTATTATCTCATTCTGG + Intergenic
1082953438 11:58843215-58843237 GAAAAAATTTTACCTCTTCCAGG - Intronic
1084200737 11:67556310-67556332 GCCACGGCATCACCTCTTCCTGG - Intergenic
1085377904 11:76083657-76083679 ACAAAGTAATTTCCTCTTCCCGG - Intronic
1085474086 11:76778610-76778632 GCTTAGGTATCACTTCTTCCAGG - Intergenic
1086066116 11:82746882-82746904 GCAAAGATATTCCCTGTTCACGG + Intergenic
1086425145 11:86675478-86675500 GCAAAAGTATTAACTATACCTGG - Intergenic
1086991676 11:93310546-93310568 GGAAAGGTATTCCATCTTCGTGG + Intergenic
1087435826 11:98116151-98116173 TAAAAAGGATTACCTCTTCCAGG - Intergenic
1087726338 11:101721218-101721240 GAATAGGTATTACATTTTCCAGG - Intronic
1087852507 11:103048586-103048608 GCATAGATATCACCTCTTCTGGG - Intergenic
1088386913 11:109268649-109268671 GCCAAGCTATTCCCTCTTTCTGG - Intergenic
1088821923 11:113463885-113463907 GCCCAGGTATCACCTCTTCCAGG - Intronic
1089666270 11:120021980-120022002 GCCAAGATGTTACCTATTCCAGG + Intergenic
1091352591 11:134908989-134909011 GCAAAGGTATTATCTCATTTTGG - Intergenic
1091604028 12:1935341-1935363 GGAGAGGCATCACCTCTTCCTGG + Intergenic
1092309764 12:7339861-7339883 GCAAATTTATAACCACTTCCTGG - Intergenic
1093169101 12:15839057-15839079 GCAAATGCATTAGCTCTGCCTGG - Intronic
1096319689 12:50600787-50600809 GCATAGCTATTTCCTCTTCCTGG + Intronic
1096841881 12:54384842-54384864 GAAAAGGTATGAGCTCTTACTGG - Intronic
1098020171 12:66146669-66146691 GCAAAGTTATAACCTCTTGGAGG + Intronic
1098241895 12:68476486-68476508 GCAAAGGGATTATATATTCCTGG - Intergenic
1099506874 12:83488787-83488809 TCAAACGTATTACCAATTCCAGG + Intergenic
1100126910 12:91438456-91438478 GTAGAGCTACTACCTCTTCCTGG + Intergenic
1101161193 12:101978377-101978399 TCAAAGCTACTATCTCTTCCAGG - Intronic
1101456960 12:104843113-104843135 GAAAAGGAAGTACCTCTACCTGG - Intronic
1103569240 12:121833473-121833495 GCTAAGGTTTTACGTCTTCTTGG - Intergenic
1105616792 13:22026209-22026231 GCACATGTATTTCCTCTGCCTGG + Intergenic
1106304505 13:28497456-28497478 TCAAAGGTATTATCTCTTTTGGG - Intergenic
1110331578 13:74278979-74279001 AAAGATGTATTACCTCTTCCTGG - Intergenic
1110831426 13:80036049-80036071 GAAAAGGGTTTAGCTCTTCCAGG - Intergenic
1113302474 13:109037248-109037270 GCGAAGTTATTGCCCCTTCCTGG + Intronic
1114473919 14:22981417-22981439 GCAAAGCTGTTAGCTCGTCCTGG + Exonic
1115358667 14:32477060-32477082 TCATGGGTATGACCTCTTCCAGG + Intronic
1115705940 14:35998347-35998369 GTACAGTTATTAACTCTTCCCGG + Intergenic
1119736552 14:76986264-76986286 GCAAATCTGTTACCTCATCCAGG - Intergenic
1121794393 14:96723373-96723395 GCAAAGGTCCCACCTCTACCTGG - Intergenic
1122255339 14:100472179-100472201 GCAAAGGAGATTCCTCTTCCTGG + Intronic
1123833835 15:24168311-24168333 GCAAAGGAATTACCGTTTACAGG - Intergenic
1126204632 15:46031476-46031498 GGAAAGGTATTCCATCTTCACGG - Intergenic
1126367804 15:47913959-47913981 GCAAAAATATTACCTTTTCTGGG + Intergenic
1129168691 15:73794538-73794560 GCCAAGATTTTATCTCTTCCAGG - Intergenic
1129293188 15:74584361-74584383 ACACAGGTCTTAACTCTTCCAGG + Intronic
1130515813 15:84625002-84625024 GCAAAGGTCTGAACTCTGCCAGG - Intronic
1130973795 15:88757267-88757289 GCAAAGGCATGCCCTCTTCTTGG - Intergenic
1131025740 15:89140013-89140035 GCAGAGGTGTTACATCATCCTGG - Intronic
1131801452 15:96073751-96073773 GCAAAGGAATCACCCCTTCCTGG - Intergenic
1134561497 16:15213956-15213978 GCAAAAATAATACTTCTTCCTGG - Intergenic
1134922035 16:18125576-18125598 GCAAAAATAATACTTCTTCCTGG - Intergenic
1135053158 16:19208662-19208684 GCAAAGCTATTATCTGTACCAGG + Intronic
1137782025 16:51105557-51105579 TCTAAGGTATCACCTCTTCCAGG + Intergenic
1137958427 16:52856672-52856694 GCATAGGTTTTTCCTCTGCCTGG - Intergenic
1138339151 16:56277280-56277302 GCAAAGGAAGCACTTCTTCCTGG + Intronic
1140296350 16:73712847-73712869 GCAAAGTTATTGCCTATTGCTGG - Intergenic
1142973212 17:3627070-3627092 CCATTGGTATTTCCTCTTCCAGG + Intronic
1148682447 17:49482499-49482521 GCACAGGCATCACCTCCTCCAGG - Intergenic
1150930481 17:69579332-69579354 GAAAAAGTATTACCTCTTTAGGG + Intergenic
1151303376 17:73245844-73245866 GCTAATGTATCATCTCTTCCTGG + Intronic
1152645742 17:81467807-81467829 GCCCAGGTGTTACTTCTTCCAGG - Intergenic
1152775409 17:82198468-82198490 GCAAAGGTAATACATTTTCAAGG + Intronic
1153610717 18:6881627-6881649 GCAAACCTATGACATCTTCCTGG - Intronic
1155321729 18:24625700-24625722 GCACAAGTCTCACCTCTTCCAGG + Intergenic
1160331760 18:77999677-77999699 TCTAAGGTATGACCTCTTCCAGG - Intergenic
1168579573 19:57543638-57543660 GAAAACGTTTTACCTCTGCCGGG + Exonic
927352922 2:22139247-22139269 GTAAAGTTCTTACCTCTTCTGGG + Intergenic
929551668 2:42897153-42897175 GAAAAGGAACTACATCTTCCTGG + Intergenic
929921072 2:46171978-46172000 GCAAAGGAAATGCCTCTTCCTGG - Intronic
935376533 2:102404780-102404802 GCAAAGGTATTCCATGTTCATGG - Intergenic
935695261 2:105765996-105766018 GCACAGGTATGACCAGTTCCTGG + Intronic
935878001 2:107533503-107533525 GTTAAGATATTAACTCTTCCAGG + Intergenic
936396976 2:112138611-112138633 GCAAAGTTATTTCCCCTCCCAGG + Exonic
936531509 2:113279409-113279431 CCACAGCTATGACCTCTTCCAGG + Intergenic
938262554 2:129906036-129906058 GGAAAGGTACCACCTCCTCCAGG - Intergenic
941269291 2:163405445-163405467 ACAAACATATTTCCTCTTCCTGG + Intergenic
942196593 2:173526916-173526938 GCAAAGGCATTTCCCCTTCTTGG + Intergenic
947502387 2:230680851-230680873 GCACAGGTATCACCTCTGCCAGG - Intergenic
1170851197 20:20005835-20005857 GCAAAGGTGTTACTTCTCGCAGG - Intergenic
1173671597 20:44802915-44802937 GCACAGTTATTCCCTCTGCCTGG + Intronic
1174985213 20:55443863-55443885 GCAAAGCTGTTACCACCTCCAGG - Intergenic
1175553888 20:59834136-59834158 GCAAAGGAAGTACCTTTTCATGG + Intronic
1176287610 21:5026832-5026854 GCAAGGGTAGGAGCTCTTCCGGG - Intronic
1179869571 21:44236643-44236665 GCAAGGGTAGGAGCTCTTCCGGG + Intronic
1182034792 22:27189372-27189394 GCTTAGGTGTCACCTCTTCCAGG - Intergenic
1183494238 22:38133357-38133379 GCAAAGGTATCACCTCTCACTGG + Intronic
949923478 3:9022519-9022541 ACTAAGGTCTTCCCTCTTCCTGG - Intronic
952877813 3:37961810-37961832 ACAGATGTAGTACCTCTTCCTGG - Intronic
954633601 3:52059646-52059668 GCACAGGTATTTCCCCTGCCTGG + Intergenic
955576988 3:60376730-60376752 TAAAACGTATTACCTTTTCCAGG + Intronic
955956346 3:64293681-64293703 GCACAGGTGTTGCTTCTTCCTGG + Intronic
957136958 3:76300739-76300761 GCAAAGAAATTCCCTCTTCCTGG + Intronic
962465288 3:135651853-135651875 GCAAAGGTCTTCCCTGTGCCAGG + Intergenic
962627246 3:137238163-137238185 GCATACATGTTACCTCTTCCTGG - Intergenic
964294185 3:155215327-155215349 GGTTAGGTATTACCTCTTCCAGG + Intergenic
970397669 4:15685595-15685617 GGAGAGGTACTACCTCTCCCAGG - Intronic
971521271 4:27554599-27554621 GCAAATGTATTACTTCTTCCTGG - Intergenic
979611488 4:122693483-122693505 GCAAAGGTATTTCTTCTCCATGG - Intergenic
981210661 4:142100295-142100317 GAAAAGATATAACCACTTCCAGG - Intronic
981730137 4:147888264-147888286 GCAAATTTATTATCTCTACCTGG + Intronic
984260715 4:177441564-177441586 GCTAAGGTATCACCTCTTCCAGG - Intronic
989245790 5:39252849-39252871 GTAAAAGTAGTACCTCATCCAGG + Intronic
989972128 5:50536999-50537021 GAAAATGTAGTACCTCATCCAGG - Intergenic
993145005 5:84083006-84083028 TAAAAGATATGACCTCTTCCAGG - Intronic
993465280 5:88237888-88237910 GTCAAGGTATTAACTCTTTCAGG + Intronic
994740117 5:103607371-103607393 ACAAAAGTATTACCTCTTCTTGG - Intergenic
1000571749 5:162923734-162923756 TCCAATGTATTACCTCTGCCAGG + Intergenic
1005156263 6:22810240-22810262 TGAACTGTATTACCTCTTCCAGG + Intergenic
1005844029 6:29763472-29763494 GCCATGGTGTTTCCTCTTCCAGG - Intergenic
1005884977 6:30090755-30090777 GCAAAGCTGTTACCTGTGCCTGG + Intergenic
1012352973 6:98276436-98276458 GCTCAGGTATCATCTCTTCCTGG + Intergenic
1012715755 6:102667317-102667339 GGAAAGGTATTACCTGGTTCTGG - Intergenic
1012944543 6:105451584-105451606 GCCAAGGAATTAACTCTTTCTGG + Intergenic
1014590725 6:123264799-123264821 GCAAAAGTATTACAACTTGCTGG + Intronic
1015673231 6:135715663-135715685 CCAATGCTATTTCCTCTTCCCGG + Intergenic
1016828999 6:148414969-148414991 AGAAATGTATTAACTCTTCCTGG - Intronic
1017149881 6:151269686-151269708 GGAAAAGTATTAATTCTTCCAGG + Intronic
1017787493 6:157768547-157768569 GCAAATGTATTTCCTCTGGCTGG - Intronic
1027049057 7:75010203-75010225 GCAAAAATATCACCTCCTCCAGG - Intronic
1028880763 7:95877146-95877168 GCTAATGTCTTGCCTCTTCCAGG - Intronic
1029295984 7:99540937-99540959 GCAATGATATCACCTCTCCCTGG + Intergenic
1029383961 7:100231456-100231478 GCAAAAATATCACCTCCTCCAGG + Intronic
1029839088 7:103343619-103343641 GTAAAGGTATCATCTATTCCTGG + Intronic
1042439435 8:68809067-68809089 GCTAAGGTCTTGCTTCTTCCCGG + Intronic
1043172881 8:76987310-76987332 GCTTAGGTATTGCCTCTCCCAGG - Intronic
1044741909 8:95336236-95336258 GCAAAGGTCTTAACTGTTGCAGG + Intergenic
1048634204 8:136278331-136278353 TCTAATGTATTACCTCTACCAGG + Intergenic
1049018644 8:139939237-139939259 GCAGAGGTGTTATCTCTTCCAGG - Intronic
1049835629 8:144733855-144733877 GCAACGGTGTTAGCTGTTCCAGG - Intronic
1050153501 9:2641286-2641308 TCACAGGTATTAGCGCTTCCAGG + Intronic
1051586110 9:18728655-18728677 GCATAGGCATTGCCTCCTCCAGG - Intronic
1053575343 9:39354112-39354134 ACAAAGGGATTACCTGTTCTGGG - Intergenic
1053839847 9:42182046-42182068 ACAAAGGGATTACCTGTTCTGGG - Intergenic
1054096905 9:60912795-60912817 ACAAAGGGATTACCTGTTCTGGG - Intergenic
1054118308 9:61188421-61188443 ACAAAGGGATTACCTGTTCTGGG - Intergenic
1054589447 9:66994143-66994165 ACAAAGGGATTACCTGTTCTGGG + Intergenic
1060053838 9:120396497-120396519 GCTCAGGTTTCACCTCTTCCAGG + Intronic
1062483097 9:136761634-136761656 GCTTAGACATTACCTCTTCCAGG - Intronic
1189685696 X:43561579-43561601 CCAAAGGTCTTACCTCTTAAAGG - Intergenic
1190405765 X:50086051-50086073 GAAAAGTTGTTACCTCTTCAAGG - Exonic
1192326368 X:70135552-70135574 GCACAGGAGTCACCTCTTCCAGG - Intronic
1193427959 X:81363515-81363537 GCAAAGGTATTACCTCTTCCAGG + Intergenic
1195385762 X:104312364-104312386 GCGTATGTATTGCCTCTTCCTGG + Intergenic
1195557482 X:106243556-106243578 CCAATGGTATTTCCTCCTCCTGG - Intergenic
1196930234 X:120674755-120674777 GCAAATGTAGTACATATTCCAGG - Intergenic
1199398573 X:147369726-147369748 GCTAAGATCTTACCACTTCCAGG + Intergenic
1200482658 Y:3726329-3726351 GCAAAGGTATTCCATGTTCATGG + Intergenic
1201446419 Y:14061392-14061414 GCAACGGTATTACTTTTTACAGG - Intergenic
1201915045 Y:19172665-19172687 GAAAAGGTATCACCTCACCCAGG + Intergenic