ID: 1193428377

View in Genome Browser
Species Human (GRCh38)
Location X:81369108-81369130
Sequence GATCTGAGAGGACCACATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193428373_1193428377 3 Left 1193428373 X:81369082-81369104 CCTGACACCTGTTGACCAAATTA No data
Right 1193428377 X:81369108-81369130 GATCTGAGAGGACCACATTTTGG No data
1193428374_1193428377 -4 Left 1193428374 X:81369089-81369111 CCTGTTGACCAAATTAAGTGATC No data
Right 1193428377 X:81369108-81369130 GATCTGAGAGGACCACATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193428377 Original CRISPR GATCTGAGAGGACCACATTT TGG Intergenic
No off target data available for this crispr