ID: 1193433315

View in Genome Browser
Species Human (GRCh38)
Location X:81438990-81439012
Sequence GCAGCCAGCAAATATAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193433315_1193433319 10 Left 1193433315 X:81438990-81439012 CCTGCTTTATATTTGCTGGCTGC No data
Right 1193433319 X:81439023-81439045 GTACCCACCAGATGCAGGGTGGG No data
1193433315_1193433316 5 Left 1193433315 X:81438990-81439012 CCTGCTTTATATTTGCTGGCTGC No data
Right 1193433316 X:81439018-81439040 AGATTGTACCCACCAGATGCAGG No data
1193433315_1193433317 6 Left 1193433315 X:81438990-81439012 CCTGCTTTATATTTGCTGGCTGC No data
Right 1193433317 X:81439019-81439041 GATTGTACCCACCAGATGCAGGG No data
1193433315_1193433318 9 Left 1193433315 X:81438990-81439012 CCTGCTTTATATTTGCTGGCTGC No data
Right 1193433318 X:81439022-81439044 TGTACCCACCAGATGCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193433315 Original CRISPR GCAGCCAGCAAATATAAAGC AGG (reversed) Intergenic
No off target data available for this crispr