ID: 1193433491

View in Genome Browser
Species Human (GRCh38)
Location X:81441741-81441763
Sequence ATCTGATGGTAGTAGTTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193433488_1193433491 10 Left 1193433488 X:81441708-81441730 CCCTATTGCAAATTTTTCTTTGC No data
Right 1193433491 X:81441741-81441763 ATCTGATGGTAGTAGTTGTATGG No data
1193433489_1193433491 9 Left 1193433489 X:81441709-81441731 CCTATTGCAAATTTTTCTTTGCT No data
Right 1193433491 X:81441741-81441763 ATCTGATGGTAGTAGTTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193433491 Original CRISPR ATCTGATGGTAGTAGTTGTA TGG Intergenic
No off target data available for this crispr