ID: 1193440882

View in Genome Browser
Species Human (GRCh38)
Location X:81538102-81538124
Sequence TCTCACTCACCACTTTCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193440879_1193440882 -5 Left 1193440879 X:81538084-81538106 CCAGCTTTCCCTCAGTTCTCTCA No data
Right 1193440882 X:81538102-81538124 TCTCACTCACCACTTTCCCAAGG No data
1193440878_1193440882 7 Left 1193440878 X:81538072-81538094 CCATAGTGAAAGCCAGCTTTCCC No data
Right 1193440882 X:81538102-81538124 TCTCACTCACCACTTTCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193440882 Original CRISPR TCTCACTCACCACTTTCCCA AGG Intergenic
No off target data available for this crispr