ID: 1193441790

View in Genome Browser
Species Human (GRCh38)
Location X:81550058-81550080
Sequence TAGGAAACTTTTGAGATGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193441790_1193441796 19 Left 1193441790 X:81550058-81550080 CCCATCATCTCAAAAGTTTCCTA No data
Right 1193441796 X:81550100-81550122 TCTCCTCTGTTTCCAGCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193441790 Original CRISPR TAGGAAACTTTTGAGATGAT GGG (reversed) Intergenic
No off target data available for this crispr