ID: 1193443247

View in Genome Browser
Species Human (GRCh38)
Location X:81568141-81568163
Sequence CTGGGGGTCTGGGGTTCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193443242_1193443247 -9 Left 1193443242 X:81568127-81568149 CCCATGCATGTTGTCTGGGGGTC No data
Right 1193443247 X:81568141-81568163 CTGGGGGTCTGGGGTTCAAATGG No data
1193443243_1193443247 -10 Left 1193443243 X:81568128-81568150 CCATGCATGTTGTCTGGGGGTCT No data
Right 1193443247 X:81568141-81568163 CTGGGGGTCTGGGGTTCAAATGG No data
1193443236_1193443247 22 Left 1193443236 X:81568096-81568118 CCTGAGCACAAGACAACTCAGCC No data
Right 1193443247 X:81568141-81568163 CTGGGGGTCTGGGGTTCAAATGG No data
1193443237_1193443247 1 Left 1193443237 X:81568117-81568139 CCTGCTTGTGCCCATGCATGTTG No data
Right 1193443247 X:81568141-81568163 CTGGGGGTCTGGGGTTCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193443247 Original CRISPR CTGGGGGTCTGGGGTTCAAA TGG Intergenic
No off target data available for this crispr