ID: 1193446770

View in Genome Browser
Species Human (GRCh38)
Location X:81615397-81615419
Sequence TTGATGTTCCTGAGGAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193446770_1193446775 21 Left 1193446770 X:81615397-81615419 CCCTTCTTCCTCAGGAACATCAA No data
Right 1193446775 X:81615441-81615463 TAACATAATCCCAAATTTCTTGG 0: 68
1: 223
2: 845
3: 7439
4: 3482
1193446770_1193446776 24 Left 1193446770 X:81615397-81615419 CCCTTCTTCCTCAGGAACATCAA No data
Right 1193446776 X:81615444-81615466 CATAATCCCAAATTTCTTGGAGG 0: 51
1: 393
2: 7119
3: 3462
4: 2004
1193446770_1193446774 -7 Left 1193446770 X:81615397-81615419 CCCTTCTTCCTCAGGAACATCAA No data
Right 1193446774 X:81615413-81615435 ACATCAATTATTGTTAGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193446770 Original CRISPR TTGATGTTCCTGAGGAAGAA GGG (reversed) Intergenic
No off target data available for this crispr