ID: 1193447152

View in Genome Browser
Species Human (GRCh38)
Location X:81618739-81618761
Sequence AGTTATCTGCAGGAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193447152_1193447159 25 Left 1193447152 X:81618739-81618761 CCTGCCATCTCCTGCAGATAACT No data
Right 1193447159 X:81618787-81618809 GGCCTATTACTGGACTTTGGTGG No data
1193447152_1193447157 15 Left 1193447152 X:81618739-81618761 CCTGCCATCTCCTGCAGATAACT No data
Right 1193447157 X:81618777-81618799 GACAGCTCTTGGCCTATTACTGG 0: 17
1: 183
2: 194
3: 123
4: 177
1193447152_1193447158 22 Left 1193447152 X:81618739-81618761 CCTGCCATCTCCTGCAGATAACT No data
Right 1193447158 X:81618784-81618806 CTTGGCCTATTACTGGACTTTGG No data
1193447152_1193447155 4 Left 1193447152 X:81618739-81618761 CCTGCCATCTCCTGCAGATAACT No data
Right 1193447155 X:81618766-81618788 TTCCTTTGAGAGACAGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193447152 Original CRISPR AGTTATCTGCAGGAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr