ID: 1193449592

View in Genome Browser
Species Human (GRCh38)
Location X:81649551-81649573
Sequence CACATGGCTCCAATGGGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193449592_1193449599 5 Left 1193449592 X:81649551-81649573 CCATTGCCCATTGGAGCCATGTG No data
Right 1193449599 X:81649579-81649601 GGCATCCTCTGAGACGCCAGAGG No data
1193449592_1193449601 14 Left 1193449592 X:81649551-81649573 CCATTGCCCATTGGAGCCATGTG No data
Right 1193449601 X:81649588-81649610 TGAGACGCCAGAGGACCACCTGG No data
1193449592_1193449602 15 Left 1193449592 X:81649551-81649573 CCATTGCCCATTGGAGCCATGTG No data
Right 1193449602 X:81649589-81649611 GAGACGCCAGAGGACCACCTGGG No data
1193449592_1193449606 26 Left 1193449592 X:81649551-81649573 CCATTGCCCATTGGAGCCATGTG No data
Right 1193449606 X:81649600-81649622 GGACCACCTGGGCAATCGGTGGG No data
1193449592_1193449605 25 Left 1193449592 X:81649551-81649573 CCATTGCCCATTGGAGCCATGTG No data
Right 1193449605 X:81649599-81649621 AGGACCACCTGGGCAATCGGTGG No data
1193449592_1193449604 22 Left 1193449592 X:81649551-81649573 CCATTGCCCATTGGAGCCATGTG No data
Right 1193449604 X:81649596-81649618 CAGAGGACCACCTGGGCAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193449592 Original CRISPR CACATGGCTCCAATGGGCAA TGG (reversed) Intergenic
No off target data available for this crispr