ID: 1193449594

View in Genome Browser
Species Human (GRCh38)
Location X:81649557-81649579
Sequence CCCACTCACATGGCTCCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193449594_1193449599 -1 Left 1193449594 X:81649557-81649579 CCCATTGGAGCCATGTGAGTGGG No data
Right 1193449599 X:81649579-81649601 GGCATCCTCTGAGACGCCAGAGG No data
1193449594_1193449606 20 Left 1193449594 X:81649557-81649579 CCCATTGGAGCCATGTGAGTGGG No data
Right 1193449606 X:81649600-81649622 GGACCACCTGGGCAATCGGTGGG No data
1193449594_1193449605 19 Left 1193449594 X:81649557-81649579 CCCATTGGAGCCATGTGAGTGGG No data
Right 1193449605 X:81649599-81649621 AGGACCACCTGGGCAATCGGTGG No data
1193449594_1193449602 9 Left 1193449594 X:81649557-81649579 CCCATTGGAGCCATGTGAGTGGG No data
Right 1193449602 X:81649589-81649611 GAGACGCCAGAGGACCACCTGGG No data
1193449594_1193449604 16 Left 1193449594 X:81649557-81649579 CCCATTGGAGCCATGTGAGTGGG No data
Right 1193449604 X:81649596-81649618 CAGAGGACCACCTGGGCAATCGG No data
1193449594_1193449601 8 Left 1193449594 X:81649557-81649579 CCCATTGGAGCCATGTGAGTGGG No data
Right 1193449601 X:81649588-81649610 TGAGACGCCAGAGGACCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193449594 Original CRISPR CCCACTCACATGGCTCCAAT GGG (reversed) Intergenic
No off target data available for this crispr