ID: 1193449596

View in Genome Browser
Species Human (GRCh38)
Location X:81649558-81649580
Sequence CCCCACTCACATGGCTCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193449596_1193449605 18 Left 1193449596 X:81649558-81649580 CCATTGGAGCCATGTGAGTGGGG No data
Right 1193449605 X:81649599-81649621 AGGACCACCTGGGCAATCGGTGG No data
1193449596_1193449602 8 Left 1193449596 X:81649558-81649580 CCATTGGAGCCATGTGAGTGGGG No data
Right 1193449602 X:81649589-81649611 GAGACGCCAGAGGACCACCTGGG No data
1193449596_1193449604 15 Left 1193449596 X:81649558-81649580 CCATTGGAGCCATGTGAGTGGGG No data
Right 1193449604 X:81649596-81649618 CAGAGGACCACCTGGGCAATCGG No data
1193449596_1193449606 19 Left 1193449596 X:81649558-81649580 CCATTGGAGCCATGTGAGTGGGG No data
Right 1193449606 X:81649600-81649622 GGACCACCTGGGCAATCGGTGGG No data
1193449596_1193449599 -2 Left 1193449596 X:81649558-81649580 CCATTGGAGCCATGTGAGTGGGG No data
Right 1193449599 X:81649579-81649601 GGCATCCTCTGAGACGCCAGAGG No data
1193449596_1193449601 7 Left 1193449596 X:81649558-81649580 CCATTGGAGCCATGTGAGTGGGG No data
Right 1193449601 X:81649588-81649610 TGAGACGCCAGAGGACCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193449596 Original CRISPR CCCCACTCACATGGCTCCAA TGG (reversed) Intergenic
No off target data available for this crispr