ID: 1193449601

View in Genome Browser
Species Human (GRCh38)
Location X:81649588-81649610
Sequence TGAGACGCCAGAGGACCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193449596_1193449601 7 Left 1193449596 X:81649558-81649580 CCATTGGAGCCATGTGAGTGGGG No data
Right 1193449601 X:81649588-81649610 TGAGACGCCAGAGGACCACCTGG No data
1193449598_1193449601 -2 Left 1193449598 X:81649567-81649589 CCATGTGAGTGGGGCATCCTCTG No data
Right 1193449601 X:81649588-81649610 TGAGACGCCAGAGGACCACCTGG No data
1193449592_1193449601 14 Left 1193449592 X:81649551-81649573 CCATTGCCCATTGGAGCCATGTG No data
Right 1193449601 X:81649588-81649610 TGAGACGCCAGAGGACCACCTGG No data
1193449594_1193449601 8 Left 1193449594 X:81649557-81649579 CCCATTGGAGCCATGTGAGTGGG No data
Right 1193449601 X:81649588-81649610 TGAGACGCCAGAGGACCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193449601 Original CRISPR TGAGACGCCAGAGGACCACC TGG Intergenic
No off target data available for this crispr