ID: 1193449602

View in Genome Browser
Species Human (GRCh38)
Location X:81649589-81649611
Sequence GAGACGCCAGAGGACCACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193449592_1193449602 15 Left 1193449592 X:81649551-81649573 CCATTGCCCATTGGAGCCATGTG No data
Right 1193449602 X:81649589-81649611 GAGACGCCAGAGGACCACCTGGG No data
1193449594_1193449602 9 Left 1193449594 X:81649557-81649579 CCCATTGGAGCCATGTGAGTGGG No data
Right 1193449602 X:81649589-81649611 GAGACGCCAGAGGACCACCTGGG No data
1193449596_1193449602 8 Left 1193449596 X:81649558-81649580 CCATTGGAGCCATGTGAGTGGGG No data
Right 1193449602 X:81649589-81649611 GAGACGCCAGAGGACCACCTGGG No data
1193449598_1193449602 -1 Left 1193449598 X:81649567-81649589 CCATGTGAGTGGGGCATCCTCTG No data
Right 1193449602 X:81649589-81649611 GAGACGCCAGAGGACCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193449602 Original CRISPR GAGACGCCAGAGGACCACCT GGG Intergenic
No off target data available for this crispr