ID: 1193459185

View in Genome Browser
Species Human (GRCh38)
Location X:81769984-81770006
Sequence TTATATATAAAAAAGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193459183_1193459185 20 Left 1193459183 X:81769941-81769963 CCAGAAAAAAGTACATGTTACTG No data
Right 1193459185 X:81769984-81770006 TTATATATAAAAAAGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193459185 Original CRISPR TTATATATAAAAAAGGAGAA AGG Intergenic
No off target data available for this crispr