ID: 1193468636

View in Genome Browser
Species Human (GRCh38)
Location X:81874671-81874693
Sequence GGACCAGGTGCACCACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193468628_1193468636 20 Left 1193468628 X:81874628-81874650 CCAGGTGCTGGCGTTCATTCCAG No data
Right 1193468636 X:81874671-81874693 GGACCAGGTGCACCACAAGCAGG No data
1193468632_1193468636 1 Left 1193468632 X:81874647-81874669 CCAGCTATCTGTGGGCCTGTGGC No data
Right 1193468636 X:81874671-81874693 GGACCAGGTGCACCACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193468636 Original CRISPR GGACCAGGTGCACCACAAGC AGG Intergenic
No off target data available for this crispr