ID: 1193468828

View in Genome Browser
Species Human (GRCh38)
Location X:81875843-81875865
Sequence TGTGCTCTTGGGAGCCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193468828_1193468838 8 Left 1193468828 X:81875843-81875865 CCTTCTGGGCTCCCAAGAGCACA No data
Right 1193468838 X:81875874-81875896 CAGGTCCACATCCCTGACTTGGG No data
1193468828_1193468843 28 Left 1193468828 X:81875843-81875865 CCTTCTGGGCTCCCAAGAGCACA No data
Right 1193468843 X:81875894-81875916 GGGTGGCCACAGCTGTACCCAGG No data
1193468828_1193468837 7 Left 1193468828 X:81875843-81875865 CCTTCTGGGCTCCCAAGAGCACA No data
Right 1193468837 X:81875873-81875895 CCAGGTCCACATCCCTGACTTGG No data
1193468828_1193468839 11 Left 1193468828 X:81875843-81875865 CCTTCTGGGCTCCCAAGAGCACA No data
Right 1193468839 X:81875877-81875899 GTCCACATCCCTGACTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193468828 Original CRISPR TGTGCTCTTGGGAGCCCAGA AGG (reversed) Intergenic
No off target data available for this crispr