ID: 1193471149

View in Genome Browser
Species Human (GRCh38)
Location X:81906203-81906225
Sequence TCTCACAGACTGAAGGTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193471149_1193471153 22 Left 1193471149 X:81906203-81906225 CCCTTTACCTTCAGTCTGTGAGA No data
Right 1193471153 X:81906248-81906270 TCCTCAACATAGCAGATATATGG No data
1193471149_1193471152 -7 Left 1193471149 X:81906203-81906225 CCCTTTACCTTCAGTCTGTGAGA No data
Right 1193471152 X:81906219-81906241 TGTGAGAAGATTTATGTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193471149 Original CRISPR TCTCACAGACTGAAGGTAAA GGG (reversed) Intergenic
No off target data available for this crispr