ID: 1193471152

View in Genome Browser
Species Human (GRCh38)
Location X:81906219-81906241
Sequence TGTGAGAAGATTTATGTATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193471148_1193471152 -3 Left 1193471148 X:81906199-81906221 CCATCCCTTTACCTTCAGTCTGT No data
Right 1193471152 X:81906219-81906241 TGTGAGAAGATTTATGTATTAGG No data
1193471150_1193471152 -8 Left 1193471150 X:81906204-81906226 CCTTTACCTTCAGTCTGTGAGAA No data
Right 1193471152 X:81906219-81906241 TGTGAGAAGATTTATGTATTAGG No data
1193471149_1193471152 -7 Left 1193471149 X:81906203-81906225 CCCTTTACCTTCAGTCTGTGAGA No data
Right 1193471152 X:81906219-81906241 TGTGAGAAGATTTATGTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193471152 Original CRISPR TGTGAGAAGATTTATGTATT AGG Intergenic
No off target data available for this crispr