ID: 1193471153

View in Genome Browser
Species Human (GRCh38)
Location X:81906248-81906270
Sequence TCCTCAACATAGCAGATATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193471149_1193471153 22 Left 1193471149 X:81906203-81906225 CCCTTTACCTTCAGTCTGTGAGA No data
Right 1193471153 X:81906248-81906270 TCCTCAACATAGCAGATATATGG No data
1193471150_1193471153 21 Left 1193471150 X:81906204-81906226 CCTTTACCTTCAGTCTGTGAGAA No data
Right 1193471153 X:81906248-81906270 TCCTCAACATAGCAGATATATGG No data
1193471148_1193471153 26 Left 1193471148 X:81906199-81906221 CCATCCCTTTACCTTCAGTCTGT No data
Right 1193471153 X:81906248-81906270 TCCTCAACATAGCAGATATATGG No data
1193471151_1193471153 15 Left 1193471151 X:81906210-81906232 CCTTCAGTCTGTGAGAAGATTTA No data
Right 1193471153 X:81906248-81906270 TCCTCAACATAGCAGATATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193471153 Original CRISPR TCCTCAACATAGCAGATATA TGG Intergenic
No off target data available for this crispr