ID: 1193473768

View in Genome Browser
Species Human (GRCh38)
Location X:81939262-81939284
Sequence CACCTTAGGCTGCTGTAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193473768_1193473775 27 Left 1193473768 X:81939262-81939284 CCTTGTTACAGCAGCCTAAGGTG No data
Right 1193473775 X:81939312-81939334 CTGGGAATTTTGTATTGGGATGG No data
1193473768_1193473773 22 Left 1193473768 X:81939262-81939284 CCTTGTTACAGCAGCCTAAGGTG No data
Right 1193473773 X:81939307-81939329 TGTTACTGGGAATTTTGTATTGG No data
1193473768_1193473774 23 Left 1193473768 X:81939262-81939284 CCTTGTTACAGCAGCCTAAGGTG No data
Right 1193473774 X:81939308-81939330 GTTACTGGGAATTTTGTATTGGG No data
1193473768_1193473770 -4 Left 1193473768 X:81939262-81939284 CCTTGTTACAGCAGCCTAAGGTG No data
Right 1193473770 X:81939281-81939303 GGTGACTAATATAATTGTCAAGG No data
1193473768_1193473771 8 Left 1193473768 X:81939262-81939284 CCTTGTTACAGCAGCCTAAGGTG No data
Right 1193473771 X:81939293-81939315 AATTGTCAAGGTAGTGTTACTGG No data
1193473768_1193473772 9 Left 1193473768 X:81939262-81939284 CCTTGTTACAGCAGCCTAAGGTG No data
Right 1193473772 X:81939294-81939316 ATTGTCAAGGTAGTGTTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193473768 Original CRISPR CACCTTAGGCTGCTGTAACA AGG (reversed) Intergenic
No off target data available for this crispr