ID: 1193478781

View in Genome Browser
Species Human (GRCh38)
Location X:82000377-82000399
Sequence CCTCCCAAGAGCACTCTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193478781_1193478787 22 Left 1193478781 X:82000377-82000399 CCTTTAAGAGTGCTCTTGGGAGG No data
Right 1193478787 X:82000422-82000444 TCAGGAGATCGAGACCATCCTGG 0: 52576
1: 63017
2: 95022
3: 179642
4: 170031
1193478781_1193478786 4 Left 1193478781 X:82000377-82000399 CCTTTAAGAGTGCTCTTGGGAGG No data
Right 1193478786 X:82000404-82000426 GGCAGGCAGATCACACAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193478781 Original CRISPR CCTCCCAAGAGCACTCTTAA AGG (reversed) Intergenic
No off target data available for this crispr