ID: 1193480547

View in Genome Browser
Species Human (GRCh38)
Location X:82022413-82022435
Sequence GGTGGTGGCAGTTATTCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193480547_1193480553 23 Left 1193480547 X:82022413-82022435 CCTTTAGAATAACTGCCACCACC No data
Right 1193480553 X:82022459-82022481 ACTGACAAGCTGTCTTTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193480547 Original CRISPR GGTGGTGGCAGTTATTCTAA AGG (reversed) Intergenic
No off target data available for this crispr