ID: 1193483240

View in Genome Browser
Species Human (GRCh38)
Location X:82053596-82053618
Sequence GTGGAGTCTCATCCTTTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193483240_1193483243 21 Left 1193483240 X:82053596-82053618 CCAAATAAAGGATGAGACTCCAC No data
Right 1193483243 X:82053640-82053662 TTCTGCTGCTACAAAAGATTAGG No data
1193483240_1193483242 -2 Left 1193483240 X:82053596-82053618 CCAAATAAAGGATGAGACTCCAC No data
Right 1193483242 X:82053617-82053639 ACATTTTATTTTGTAAATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193483240 Original CRISPR GTGGAGTCTCATCCTTTATT TGG (reversed) Intergenic
No off target data available for this crispr