ID: 1193483700

View in Genome Browser
Species Human (GRCh38)
Location X:82059875-82059897
Sequence ATGTTGAACCTGGACACTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193483689_1193483700 30 Left 1193483689 X:82059822-82059844 CCAATCTCTGTATGTTCAACTTG No data
Right 1193483700 X:82059875-82059897 ATGTTGAACCTGGACACTGGAGG No data
1193483691_1193483700 4 Left 1193483691 X:82059848-82059870 CCATAGGAGATTTTAGCCCCAGG No data
Right 1193483700 X:82059875-82059897 ATGTTGAACCTGGACACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193483700 Original CRISPR ATGTTGAACCTGGACACTGG AGG Intergenic
No off target data available for this crispr