ID: 1193485752

View in Genome Browser
Species Human (GRCh38)
Location X:82084096-82084118
Sequence GGTACCATTGCACTCCAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193485748_1193485752 9 Left 1193485748 X:82084064-82084086 CCTGGGAGGCAGAGGTTGCAGTG 0: 42926
1: 118492
2: 185698
3: 163197
4: 108526
Right 1193485752 X:82084096-82084118 GGTACCATTGCACTCCAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193485752 Original CRISPR GGTACCATTGCACTCCAACT TGG Intergenic
No off target data available for this crispr