ID: 1193498542

View in Genome Browser
Species Human (GRCh38)
Location X:82241914-82241936
Sequence TACCCAAAACTGGGGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193498542_1193498546 -7 Left 1193498542 X:82241914-82241936 CCTTTTTTCCCCAGTTTTGGGTA No data
Right 1193498546 X:82241930-82241952 TTGGGTATGTCTTTATCAGCAGG 0: 18
1: 58
2: 75
3: 94
4: 196
1193498542_1193498547 13 Left 1193498542 X:82241914-82241936 CCTTTTTTCCCCAGTTTTGGGTA No data
Right 1193498547 X:82241950-82241972 AGGATGAAAACAGACTAATACGG No data
1193498542_1193498548 14 Left 1193498542 X:82241914-82241936 CCTTTTTTCCCCAGTTTTGGGTA No data
Right 1193498548 X:82241951-82241973 GGATGAAAACAGACTAATACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193498542 Original CRISPR TACCCAAAACTGGGGAAAAA AGG (reversed) Intergenic
No off target data available for this crispr