ID: 1193499145

View in Genome Browser
Species Human (GRCh38)
Location X:82251767-82251789
Sequence GGGTGCTGACAAAAGCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193499142_1193499145 -9 Left 1193499142 X:82251753-82251775 CCATGAGAGAAGAAGGGTGCTGA No data
Right 1193499145 X:82251767-82251789 GGGTGCTGACAAAAGCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193499145 Original CRISPR GGGTGCTGACAAAAGCTGGT GGG Intergenic
No off target data available for this crispr