ID: 1193500455

View in Genome Browser
Species Human (GRCh38)
Location X:82267589-82267611
Sequence CTAGAATTTCTATACATCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 23, 1: 33, 2: 30, 3: 26, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193500455_1193500456 -4 Left 1193500455 X:82267589-82267611 CCGGAGATGTATAGAAATTCTAG 0: 23
1: 33
2: 30
3: 26
4: 159
Right 1193500456 X:82267608-82267630 CTAGTAACTTGTAATTTTTGAGG No data
1193500455_1193500457 4 Left 1193500455 X:82267589-82267611 CCGGAGATGTATAGAAATTCTAG 0: 23
1: 33
2: 30
3: 26
4: 159
Right 1193500457 X:82267616-82267638 TTGTAATTTTTGAGGAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193500455 Original CRISPR CTAGAATTTCTATACATCTC CGG (reversed) Intergenic
902452056 1:16502647-16502669 CTAGAATTTCTATACATCTCTGG - Intergenic
902500895 1:16911020-16911042 CTAGAATTTCTATACATCTCTGG + Intronic
904338721 1:29816941-29816963 CTAGAACTTTTATACATGTTTGG - Intergenic
904414167 1:30345817-30345839 TTAGAATTTCCATATACCTCTGG + Intergenic
904512534 1:31024380-31024402 CTACAATTTAAATATATCTCAGG + Intronic
905261182 1:36720495-36720517 CTAGAATTTTCATACATTGCTGG - Intergenic
906317624 1:44798538-44798560 CTAGTATTTCTCCACATCTGAGG + Intergenic
906987141 1:50695536-50695558 CTAGAATTTTTATATACCTGTGG - Intronic
908321705 1:62984902-62984924 CTTGAATTCCTTTTCATCTCTGG - Intergenic
908779500 1:67676685-67676707 CTGAATTTTCTAAACATCTCTGG + Intergenic
908880844 1:68731070-68731092 CTATAATTTTTATACATTACAGG - Intergenic
910933737 1:92468541-92468563 TTAAAATTTCTAAACATCTCTGG - Intergenic
911015409 1:93326644-93326666 ATAGAATTTCCTTTCATCTCTGG - Intergenic
912462675 1:109846982-109847004 CTAGAATTCTTATAAATCTCTGG + Intergenic
912616932 1:111111326-111111348 TTGGAATTTGTATACATTTCTGG - Intergenic
914383055 1:147137420-147137442 CCAGAATTACTATACAGCTATGG - Intergenic
915114234 1:153585604-153585626 TTACAATTTCTGTACATCTCAGG - Intergenic
916199089 1:162252643-162252665 CAAGAATTTCTATTAATCCCTGG + Intronic
916699726 1:167279432-167279454 CAAGAATTTCTATATTTATCTGG - Intronic
917507305 1:175639328-175639350 GTAAAATTTCTATACATCTCTGG + Intronic
917800485 1:178565229-178565251 CAAGAATTTCTAGACCTCTCTGG - Intergenic
919192416 1:194239854-194239876 ATAGCATTTCAATACATTTCTGG - Intergenic
920104283 1:203539931-203539953 CTTGAATTGCTATACATTTCTGG - Intergenic
921292644 1:213672869-213672891 CTGGCATTTCCATCCATCTCAGG + Intergenic
921404759 1:214766270-214766292 CTAGAATCTTTGTACATCGCTGG - Intergenic
921746120 1:218742655-218742677 ATAGAATATCTGCACATCTCGGG + Intergenic
922224059 1:223630017-223630039 CTAGAATATGTATATAGCTCTGG - Intronic
924081551 1:240404353-240404375 GTAGTCTTTCTATTCATCTCCGG - Intronic
1063334021 10:5192360-5192382 TTAGAATTTCTATTTATTTCTGG - Intergenic
1068176509 10:53466644-53466666 GTAAGTTTTCTATACATCTCTGG + Intergenic
1069173846 10:65265441-65265463 CTAGGACTGCTATACATTTCTGG + Intergenic
1069249792 10:66254315-66254337 CTAGAATTTCTATAGATCTCTGG + Intronic
1072426069 10:95331900-95331922 CTAGAATTTCTACACATCTCTGG + Intronic
1078680242 11:13469103-13469125 CTAAAATTCCTATATATCTCTGG + Intergenic
1080114850 11:28610566-28610588 TTGGAAATTCTATACATCTTTGG + Intergenic
1080297481 11:30747003-30747025 TCAGAATTTCTCTACCTCTCAGG - Intergenic
1081894254 11:46571272-46571294 CTAGAATTTCTAAAAATTACAGG - Intronic
1082013924 11:47470189-47470211 ATAGAAGTTTTATACAGCTCCGG - Intronic
1084024840 11:66441357-66441379 CTAGAATTTCTAAACATCTCGGG + Intronic
1085570791 11:77556275-77556297 GTAAAATTTCTATACATCTCTGG + Intronic
1086749654 11:90475590-90475612 ATAAAATTTCTCCACATCTCAGG - Intergenic
1088154991 11:106791626-106791648 CTACAATTTTTATATATCTACGG + Intronic
1089382074 11:118041028-118041050 GTAATATTTCTATACATCACTGG + Intergenic
1089890779 11:121878726-121878748 CTAAAATTTCTATATGTCTCTGG - Intergenic
1090051943 11:123387636-123387658 CCAGCATTTCCAGACATCTCAGG + Intergenic
1092833841 12:12469662-12469684 CTAGAATTTTAATACATGTCTGG - Exonic
1093017253 12:14167017-14167039 CTAGCAATTCTCTACACCTCCGG + Intergenic
1093074127 12:14739642-14739664 CAAAAATTTCTATACATCTCTGG + Intergenic
1093945064 12:25098976-25098998 CTAGCTTTTCTCTACATCACGGG + Intronic
1097728568 12:63101801-63101823 TTAGAACTTCTATACATCTCTGG + Intergenic
1098407665 12:70142873-70142895 CTAAAATTTCTATACATCTCTGG - Intergenic
1099718890 12:86335731-86335753 CTAGAATTTCTATACATCTCTGG + Intronic
1100208030 12:92372559-92372581 CTAGAATTCCCATACATTGCTGG - Intergenic
1100427327 12:94499374-94499396 CTAGAATTTTTATACATCTTGGG + Intergenic
1106845934 13:33737841-33737863 CTACAATTTCTATATGTATCTGG + Intergenic
1109556183 13:63978747-63978769 AAAGAAATTCTATGCATCTCTGG + Intergenic
1109582590 13:64362369-64362391 CTAGAATTTCTATATATCTCTGG + Intergenic
1110234805 13:73205561-73205583 CTAGAATTTATAAATATCTTTGG + Intergenic
1110888490 13:80669116-80669138 CTAGCATTTCTAAAAATTTCTGG - Intergenic
1113252239 13:108466519-108466541 CTAGGATTTCTATAAATTACTGG + Intergenic
1114132905 14:19813667-19813689 CTAGAATTTCTATACATCTCTGG - Intronic
1114347213 14:21808605-21808627 CTAGAATTTCTATACATCTCTGG + Intergenic
1115874992 14:37851508-37851530 CTGGGATTTCTTTACAACTCGGG + Intronic
1116069075 14:40019678-40019700 CTAGAGTTTCTATAACTCCCTGG - Intergenic
1118672023 14:68139231-68139253 CTAAAATTTCAAAACATCTCTGG + Intronic
1120148452 14:81005051-81005073 CTAGAGTTTGAAAACATCTCTGG + Intronic
1120732358 14:88017966-88017988 CTGGAAATTCTATTGATCTCAGG - Intergenic
1121062068 14:90921411-90921433 CTAGAATTTCTACATACCTAAGG - Intronic
1123575994 15:21669491-21669513 CCAGAATTTCTATGCATCTCTGG - Intergenic
1123612615 15:22111965-22111987 CCAGAATTTCTATGCATCTCTGG - Intergenic
1125516793 15:40324981-40325003 CTAGAAATTTAATGCATCTCTGG - Intergenic
1128058486 15:64718422-64718444 CTAGACCTTCTCTCCATCTCTGG - Intergenic
1130216923 15:81980565-81980587 CTAGAATTTTTATCCATTACTGG + Intergenic
1130822431 15:87509501-87509523 GTAGCATTTCAAAACATCTCTGG + Intergenic
1131007842 15:88993092-88993114 CTAGAATTTCTATACATCTCTGG - Intergenic
1131082549 15:89548839-89548861 CTAGACTTTCTATACACTTATGG - Intergenic
1131202698 15:90413588-90413610 CTAGACTTTCTATACATCTCTGG - Intronic
1131354807 15:91735478-91735500 CTAGTTTTTCTACACATGTCGGG - Intergenic
1202984862 15_KI270727v1_random:403736-403758 CCAGAATTTCTATGCATCTCTGG - Intergenic
1139075302 16:63439657-63439679 CTAAAATTTCTCTCCAGCTCAGG + Intergenic
1140625128 16:76784315-76784337 ATAGTATTTCTACACATTTCTGG + Intergenic
1149768289 17:59298679-59298701 CTAGAATTTCTATACATCTCAGG + Intergenic
1154458927 18:14559566-14559588 CCAGAATTTCTATGCATCTCTGG - Intergenic
1155016120 18:21841599-21841621 TTAGAATTTGTATACATTGCTGG + Intronic
1155559641 18:27061874-27061896 CTAGAATTTCTATACATTTCTGG + Intronic
1155858116 18:30860677-30860699 CTAGATTTAATATACATATCAGG - Intergenic
1156727312 18:40144832-40144854 CTAGAAATTTCATACAACTCTGG - Intergenic
1158531071 18:58262213-58262235 GCAGAATGTCTATACATTTCTGG + Intronic
1159998210 18:74988847-74988869 CTAGAATTTTCAGACATCGCTGG + Intronic
1160600180 18:80006543-80006565 ATAAAATTTCTAAACATCTCTGG - Intronic
1164411230 19:28007264-28007286 CCAGATGTTCTATACATCTTGGG + Intergenic
1166010167 19:39935642-39935664 TGAGAATTTTTTTACATCTCTGG - Intergenic
926534759 2:14097967-14097989 CTATAATTTCCTTACTTCTCTGG + Intergenic
927261181 2:21092711-21092733 CTAGAATTTCTCTAGCTCTCTGG + Intergenic
927321288 2:21748761-21748783 CTAGAATGTCTATAGATTTCTGG - Intergenic
927348243 2:22073005-22073027 GTAGCATTTCTATACACCTATGG + Intergenic
928618163 2:33059881-33059903 CTAGACTTTAGATACATCTATGG + Intronic
930573303 2:53113555-53113577 CTAGAATTTCTGTACATCTCCGG - Intergenic
932248960 2:70222966-70222988 TCAGAATTTGTATACATCTCTGG + Intronic
933098410 2:78218211-78218233 TTAGAATTTCTATACATCTCTGG + Intergenic
933399204 2:81770438-81770460 CAAGACTTTCTATAAATCTATGG - Intergenic
933399306 2:81772259-81772281 CAAGATTTTCTATAAATCTATGG - Intergenic
933444484 2:82361610-82361632 CAAGAATTTCTCTTCATCTTTGG + Intergenic
937838811 2:126503740-126503762 TTAGCTTTTCTGTACATCTCCGG + Intergenic
937979014 2:127602255-127602277 GTAGAGTTTCTATACTTCACTGG - Intronic
938611350 2:132950529-132950551 CAAGAATTTACATTCATCTCAGG + Intronic
939647507 2:144718736-144718758 AGAGAACTTCTATACATTTCTGG - Intergenic
940077729 2:149762074-149762096 CTAGAACTCTTATACATCGCTGG - Intergenic
940422357 2:153495171-153495193 CTAGAATTCTCATACATCACTGG + Intergenic
940611076 2:155992739-155992761 TTAGAATTTCTATATATTCCTGG + Intergenic
941199204 2:162488588-162488610 CAAAACTTTCTATACATCTCTGG + Intronic
942363676 2:175199326-175199348 TTAAAATTTCTATACATCAAAGG + Intergenic
942888788 2:180962332-180962354 CTTTAATATATATACATCTCAGG + Intergenic
943540396 2:189206528-189206550 GTAGAACTTCTATCCATCCCAGG - Intergenic
944110113 2:196123094-196123116 CTCGAATTTCTTTACCACTCTGG - Intergenic
944934225 2:204550867-204550889 CTTGAATTTCTAAACTTTTCAGG + Intronic
945557690 2:211299855-211299877 CTAGAATTTCTATACATCTCTGG - Intergenic
948435769 2:237953102-237953124 TTCGAATTTCTATACATCTGCGG - Intergenic
948882547 2:240867629-240867651 CTAGAATTTCTATACATCTCTGG + Intergenic
1168823215 20:791199-791221 CTAGAATTTCTATGCATCTCTGG + Intergenic
1168825466 20:810440-810462 GTAGCATTTCTAAACATCTCTGG + Intergenic
1169081685 20:2801019-2801041 CTAGAATTTCTGTACGTTTCCGG + Intergenic
1169082160 20:2804258-2804280 CTAGAATTTCTATACATCTCCGG + Intergenic
1169553116 20:6721574-6721596 TTACAATTCCTAAACATCTCAGG - Intergenic
1169719473 20:8658362-8658384 CCATAATTTCTATACCTCTATGG - Intronic
1169792346 20:9424821-9424843 ATATAATTTCTATACTTCACTGG + Intronic
1169999443 20:11598033-11598055 CTAGAATTTCTATACATCTCTGG + Intergenic
1171002715 20:21430777-21430799 CTAGAATTTATCTACATTGCTGG + Intergenic
1173822365 20:46028001-46028023 CTAGAAGATCTAAACATCTGAGG - Intronic
1176815215 21:13593759-13593781 CCAGAATTTCTATGCATCTCTGG + Intergenic
1183066532 22:35367377-35367399 TTAGAATTTCTCTACATCTCTGG + Intergenic
1183789247 22:40051740-40051762 CTAGAAAATCTATACATATGTGG - Intronic
1185387773 22:50544217-50544239 CGCGAATTTCTCTACATTTCCGG - Intergenic
949109419 3:240707-240729 CTAGAATTTTTATAGGTATCGGG + Intronic
949439250 3:4062790-4062812 CTAGAATTGCTGTACATCTCCGG - Intronic
951240469 3:20280654-20280676 CTAAAATTTCTATACTTCTCTGG - Intergenic
951360115 3:21715104-21715126 CTAAAATTTATATACATTTATGG + Intronic
952332383 3:32376027-32376049 CTGGAATTTTTATACACCGCTGG + Intergenic
954669611 3:52282482-52282504 CTAAAATTTCTAGGCATCTCTGG - Intronic
957981287 3:87514639-87514661 CTAGAATTTGTACAGTTCTCTGG - Intergenic
958800651 3:98751306-98751328 CTATACTTTCTATACATTTAAGG + Intronic
959051958 3:101532949-101532971 CTAGAATTTCTATACATCTCTGG - Intergenic
962481544 3:135802528-135802550 TTAGAATTTCTATACATCTCTGG - Intergenic
963456042 3:145549489-145549511 CTAAAATTTTTATATACCTCTGG - Intergenic
963635929 3:147795931-147795953 TTAGAATTTCTATCATTCTCTGG + Intergenic
965272267 3:166633401-166633423 CTAGATTGTCTATATATCACTGG - Intergenic
965447714 3:168796326-168796348 CTAGTATTTCTTTCCATCTCTGG + Intergenic
965896924 3:173589197-173589219 CTAAAATTTCTATACAAACCAGG - Intronic
966196895 3:177322845-177322867 CTAGAAGTTCTATACAGTTGGGG - Intergenic
967476506 3:189927218-189927240 CTAGAATTTCAATATACCTGAGG - Intergenic
967674007 3:192274167-192274189 CTGGAATTTCAGTATATCTCTGG - Intronic
971148454 4:24005525-24005547 CCAGCATTTTTATACTTCTCTGG + Intergenic
971588583 4:28437060-28437082 CTAGAATTTCTATACATCTCTGG + Intergenic
972053844 4:34774853-34774875 CTAAAATTTATATACATCTCTGG - Intergenic
972444066 4:39126866-39126888 CTAGAATTTTTATACATCTCCGG + Intergenic
973982402 4:56317045-56317067 CTAGAATTTCTAGACATCTCTGG - Intronic
974574323 4:63698375-63698397 CTAGAATTTCTGTACATCTCTGG + Intergenic
974746415 4:66084014-66084036 CTAGAATTTCTATAAATTTCTGG - Intergenic
974823160 4:67093801-67093823 ATTCAATTTCTAAACATCTCAGG - Intergenic
976832826 4:89334110-89334132 TTGGAATTTCTAAACATGTCAGG + Intergenic
977933692 4:102776665-102776687 CTAGAATTCTTGTACATCACTGG + Intergenic
979144721 4:117229992-117230014 CTTGAATATCTATACATTTCTGG + Intergenic
981127502 4:141123456-141123478 CTAGAATTTCTATACATCTCCGG + Intronic
981405966 4:144369435-144369457 CTAAAATTTCTATGGATTTCAGG + Intergenic
983336729 4:166403839-166403861 TTAAAATTTCCATACATCCCAGG + Intergenic
983548083 4:168984344-168984366 GTAGAATTGCTTTACCTCTCTGG - Intronic
986231265 5:5866699-5866721 CTAGATTTTCTGTACAATTCAGG - Intergenic
986523960 5:8652600-8652622 CTAGAATTTCTCTGCACCCCTGG - Intergenic
986550963 5:8955260-8955282 AGAGAATCTTTATACATCTCAGG + Intergenic
987021229 5:13874258-13874280 CTGGAACTTCTATCCATTTCTGG - Intronic
987573839 5:19701888-19701910 CTAAAATTTCTATACATCTACGG + Intronic
987996258 5:25284415-25284437 CTTCTATTTCTATACATCACAGG - Intergenic
988145682 5:27303252-27303274 ATAGAATTTCTACACATTTGGGG + Intergenic
988458114 5:31406173-31406195 CTAGCGTTTCCATACAGCTCAGG + Intronic
989341983 5:40386433-40386455 CTAGGGTTTCTCTACATCTGTGG + Intergenic
990103325 5:52220953-52220975 CTAGATTTTCTCTGCATCTCTGG + Intergenic
993979063 5:94521202-94521224 CCAGAGTTTTTATACAGCTCAGG - Intronic
993982119 5:94555435-94555457 CTAGATTATCTATATATATCTGG + Intronic
994410283 5:99399413-99399435 CTAGCTTTTCAAAACATCTCAGG + Intergenic
994483537 5:100365863-100365885 CTAGCTTTTCAAAACATCTCAGG - Intergenic
994665180 5:102696636-102696658 CTAACATTTCTATACATCTCTGG + Intergenic
995602707 5:113815760-113815782 CTAGAATTTCCATACATTACTGG + Intergenic
995771271 5:115673083-115673105 CCATAATTTCTATAAATTTCTGG - Intergenic
996947536 5:129088634-129088656 CTAGAACTTTTATACATTGCAGG - Intergenic
997467148 5:134095950-134095972 CTAGAATTTCTCTATGGCTCTGG - Intergenic
997930323 5:138067454-138067476 TTAAAATTTCTATACATTTCCGG + Intergenic
997959220 5:138306281-138306303 CTAGAATTTATATTCTTGTCAGG - Intronic
999401749 5:151269693-151269715 CTAAAATTTCTGTACATCTCCGG + Exonic
999689887 5:154137691-154137713 CTAGAATTTTCACATATCTCTGG - Intronic
1000562544 5:162808924-162808946 CTAGATTTTGTATACATACCTGG + Intergenic
1001072612 5:168600057-168600079 CTAGAATTTCTATGCATCTCTGG - Intergenic
1001938591 5:175725143-175725165 CTAAAATTTCTATCCATCTCCGG - Intergenic
1004863641 6:19833019-19833041 CTAGAATTTTTATATTTCTTAGG - Intergenic
1005194285 6:23264993-23265015 CCAGAATTTCTATACACCTCCGG + Intergenic
1005264989 6:24102301-24102323 CTAGATTTTTTATACATCTCTGG - Intergenic
1006699868 6:35963347-35963369 CAAAATTTTCTATACATCTCTGG + Intronic
1007064995 6:38981137-38981159 GTAGAATCCCTATACATCTATGG - Intronic
1009319501 6:62269611-62269633 CCAGAATTTTCATACATCCCTGG + Intronic
1009668000 6:66707571-66707593 CTAGAATTTCTGTACATCTCTGG + Intergenic
1010010271 6:71040730-71040752 CTAAAATTTCTATACATCTCTGG - Intergenic
1011990368 6:93508213-93508235 CTAGAATTTCTTTACATCTCCGG + Intergenic
1013261531 6:108448845-108448867 TTTGAATTTATATACTTCTCAGG - Intronic
1013429142 6:110040395-110040417 CTAAAATTTCTATACATCTCCGG - Intergenic
1016378518 6:143449390-143449412 AAAGAATTTCTAGACCTCTCTGG + Intronic
1017299609 6:152841237-152841259 CTAGAATGTCTATACATCTCTGG - Intergenic
1018911892 6:168105997-168106019 CTAGGGTTTCTATACATCTCTGG - Intergenic
1020763797 7:12296704-12296726 CCAGAATTTCTATTCATCTCTGG - Intergenic
1021041558 7:15869257-15869279 CGAGAATTCCTAGAAATCTCTGG + Intergenic
1021051064 7:15985588-15985610 GTAGAATTTCTAGAGATATCAGG + Intergenic
1021794255 7:24237512-24237534 CTAGAATTTCTATACATCTCTGG + Intergenic
1022126076 7:27358799-27358821 CTAGCATTTCTAGAGTTCTCAGG - Intergenic
1022311058 7:29195905-29195927 GTAGAATTCCTGTACCTCTCTGG + Intronic
1022985787 7:35652104-35652126 CTAAAATTTCTATACATTTCTGG + Intronic
1023198341 7:37666148-37666170 CTAGAATTTCTATACATCTCTGG + Intergenic
1023216466 7:37868396-37868418 CTAGAATTTCTATACATCTCCGG - Intronic
1023933707 7:44724068-44724090 TTAGAATTTCTATACATCTCTGG - Intergenic
1024206780 7:47169712-47169734 TTAGAATTTCTAGCCATCACAGG + Intergenic
1027193949 7:76015399-76015421 CTAGGATTTCTATAGTTTTCAGG - Intronic
1027560655 7:79724827-79724849 CTAGAATTTGTGTACATGTAAGG - Intergenic
1027638825 7:80708706-80708728 CTTGAACTTCTAGAGATCTCAGG + Intergenic
1028340316 7:89711215-89711237 ATAGAAAATCTATACATCTTTGG - Intergenic
1028388364 7:90285853-90285875 CTAGAATTTCTATATATGTGAGG + Intronic
1034902943 7:154918891-154918913 CTAGAATTTCTATACATCTCTGG + Intergenic
1035273661 7:157734563-157734585 CTAAAATATTTGTACATCTCTGG - Intronic
1038052174 8:23824337-23824359 CTAAAATTTCTAAACATTTTAGG + Intergenic
1038982732 8:32777180-32777202 TTAAAATTTCTCTGCATCTCTGG - Intergenic
1039354595 8:36801137-36801159 CTAGAATTTCTATACATCTCTGG - Intronic
1040040774 8:42914976-42914998 GAGTAATTTCTATACATCTCTGG - Intronic
1040500424 8:48000179-48000201 CTAGAATTTCTATACGTCTCTGG + Intergenic
1040830320 8:51668822-51668844 CTAATATTTCTATAAATTTCTGG - Intronic
1040922016 8:52631545-52631567 CTAGAATTTCTATACATCTCTGG + Intronic
1041974838 8:63785975-63785997 CTAAAATGTCTATAAATTTCTGG - Intergenic
1044245841 8:89944363-89944385 CTAAAATTTTTATACATCTCTGG + Intronic
1048105763 8:131407339-131407361 CTAGATTTTCTACAGATCTAGGG + Intergenic
1050990548 9:12145914-12145936 CCAGAATTTCTATACATCTCTGG + Intergenic
1051385295 9:16501649-16501671 TTAGATTTTCTATGTATCTCAGG - Intronic
1052018881 9:23502058-23502080 CTAGAATTTTTATATATAGCTGG - Intergenic
1052135768 9:24908154-24908176 CCAGAATTGCTATACATCTCTGG + Intergenic
1052587999 9:30453744-30453766 CTAAAGTTTCTGTACTTCTCTGG - Intergenic
1054950318 9:70843318-70843340 CTAGAATTCATATACAAATCTGG - Intronic
1055670180 9:78596882-78596904 CTAAAATGTTTATACATCACAGG + Intergenic
1055712870 9:79083770-79083792 CTAGAATTTCTATGAATCTCTGG + Intergenic
1055976461 9:81959849-81959871 CTAAAATCTCTGTACAGCTCTGG - Intergenic
1058408149 9:104700475-104700497 CTAGAATTTCTATACATCTCAGG + Intergenic
1058833273 9:108838164-108838186 CTAGAATTCCTATACATCTCCGG + Intergenic
1059530149 9:115028042-115028064 CTGGAACTTCTATACATCTCTGG + Intronic
1059582189 9:115563540-115563562 ATTCAATTTCTATAAATCTCTGG + Intergenic
1059595244 9:115713195-115713217 CTGGAATTTCTATACATCTCTGG - Intergenic
1059857982 9:118422462-118422484 TTATAATTTCTGAACATCTCAGG + Intergenic
1061426089 9:130499334-130499356 ATTGAATTTCTGTACAACTCAGG - Intronic
1061720771 9:132549894-132549916 CTAAAAATTCTATACCTCTGAGG - Intronic
1203532143 Un_GL000213v1:155663-155685 CCAGAATTTCTATGCATCTCTGG - Intergenic
1185941347 X:4323095-4323117 CTAGAATTTCTACACATCTCTGG - Intergenic
1186168866 X:6856370-6856392 CTAGAATTTCTATACATTTCTGG + Intergenic
1186373154 X:8967445-8967467 CTAAAATTTCTCTGCATCTCTGG - Intergenic
1186384291 X:9093462-9093484 CTAAAATTTCTATACATCTCTGG + Intronic
1188524468 X:31074198-31074220 TCAGAATTTCTAAGCATCTCAGG + Intergenic
1188988843 X:36792378-36792400 CTTGAACTTCTACCCATCTCTGG + Intergenic
1189692890 X:43635458-43635480 CTAGAATTTCTATACATCCCTGG - Intergenic
1191069579 X:56385797-56385819 CTAGAATTTCTATACATCTCTGG - Intergenic
1193500455 X:82267589-82267611 CTAGAATTTCTATACATCTCCGG - Intergenic
1193807499 X:86012493-86012515 CTAAAATTTCTATACATCTCTGG + Intronic
1195292251 X:103440644-103440666 CTAGAATTTCTGTACATCTCTGG - Intergenic
1195409870 X:104558363-104558385 CTAGCATTCCTATATATCACTGG + Intergenic
1195541671 X:106069272-106069294 CTATAATTTCTATACATCTCTGG - Intergenic
1197498097 X:127210607-127210629 CTAGGATTTCTGTCCTTCTCAGG + Intergenic
1198640832 X:138754750-138754772 CTAGAATTTTGGTACATCCCAGG + Intronic
1198844327 X:140894010-140894032 CTAGAATTTGTATACATCTCTGG + Intergenic
1200667088 Y:6038315-6038337 CTAGTATTTCTGGACCTCTCAGG - Intergenic
1201559249 Y:15298790-15298812 CTAGAATTTCTACACATTTCTGG + Intergenic
1201725655 Y:17148283-17148305 CTGGGATTTCTCTACATTTCAGG + Intergenic