ID: 1193500457

View in Genome Browser
Species Human (GRCh38)
Location X:82267616-82267638
Sequence TTGTAATTTTTGAGGAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193500455_1193500457 4 Left 1193500455 X:82267589-82267611 CCGGAGATGTATAGAAATTCTAG 0: 23
1: 33
2: 30
3: 26
4: 159
Right 1193500457 X:82267616-82267638 TTGTAATTTTTGAGGAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193500457 Original CRISPR TTGTAATTTTTGAGGAAAGA AGG Intergenic
No off target data available for this crispr