ID: 1193507940

View in Genome Browser
Species Human (GRCh38)
Location X:82365611-82365633
Sequence ATGCCCTTTTAAAAAAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193507938_1193507940 1 Left 1193507938 X:82365587-82365609 CCATGGAAAAAGGACCTACAAAT No data
Right 1193507940 X:82365611-82365633 ATGCCCTTTTAAAAAAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193507940 Original CRISPR ATGCCCTTTTAAAAAAGTGA AGG Intergenic
No off target data available for this crispr