ID: 1193507943

View in Genome Browser
Species Human (GRCh38)
Location X:82365619-82365641
Sequence TTAAAAAAGTGAAGGTGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193507939_1193507943 -5 Left 1193507939 X:82365601-82365623 CCTACAAATGATGCCCTTTTAAA No data
Right 1193507943 X:82365619-82365641 TTAAAAAAGTGAAGGTGTTCTGG No data
1193507938_1193507943 9 Left 1193507938 X:82365587-82365609 CCATGGAAAAAGGACCTACAAAT No data
Right 1193507943 X:82365619-82365641 TTAAAAAAGTGAAGGTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193507943 Original CRISPR TTAAAAAAGTGAAGGTGTTC TGG Intergenic
No off target data available for this crispr