ID: 1193507944

View in Genome Browser
Species Human (GRCh38)
Location X:82365630-82365652
Sequence AAGGTGTTCTGGCAGTGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193507941_1193507944 -7 Left 1193507941 X:82365614-82365636 CCCTTTTAAAAAAGTGAAGGTGT No data
Right 1193507944 X:82365630-82365652 AAGGTGTTCTGGCAGTGTTCTGG No data
1193507938_1193507944 20 Left 1193507938 X:82365587-82365609 CCATGGAAAAAGGACCTACAAAT No data
Right 1193507944 X:82365630-82365652 AAGGTGTTCTGGCAGTGTTCTGG No data
1193507942_1193507944 -8 Left 1193507942 X:82365615-82365637 CCTTTTAAAAAAGTGAAGGTGTT No data
Right 1193507944 X:82365630-82365652 AAGGTGTTCTGGCAGTGTTCTGG No data
1193507939_1193507944 6 Left 1193507939 X:82365601-82365623 CCTACAAATGATGCCCTTTTAAA No data
Right 1193507944 X:82365630-82365652 AAGGTGTTCTGGCAGTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193507944 Original CRISPR AAGGTGTTCTGGCAGTGTTC TGG Intergenic
No off target data available for this crispr