ID: 1193509854

View in Genome Browser
Species Human (GRCh38)
Location X:82385352-82385374
Sequence ATTTTTTTAATGATGAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193509854_1193509856 1 Left 1193509854 X:82385352-82385374 CCATGTTTCATCATTAAAAAAAT No data
Right 1193509856 X:82385376-82385398 AAAGATGCTGCAGGAAAAAGTGG No data
1193509854_1193509855 -8 Left 1193509854 X:82385352-82385374 CCATGTTTCATCATTAAAAAAAT No data
Right 1193509855 X:82385367-82385389 AAAAAAATAAAAGATGCTGCAGG No data
1193509854_1193509857 21 Left 1193509854 X:82385352-82385374 CCATGTTTCATCATTAAAAAAAT No data
Right 1193509857 X:82385396-82385418 TGGCTTTTTAAAAAATGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193509854 Original CRISPR ATTTTTTTAATGATGAAACA TGG (reversed) Intergenic
No off target data available for this crispr