ID: 1193524621

View in Genome Browser
Species Human (GRCh38)
Location X:82573681-82573703
Sequence CACTGAAAGAGAAACTGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193524621_1193524624 6 Left 1193524621 X:82573681-82573703 CCTCTTCAGTTTCTCTTTCAGTG No data
Right 1193524624 X:82573710-82573732 ATTTAACACCAGGAACTACAAGG No data
1193524621_1193524627 23 Left 1193524621 X:82573681-82573703 CCTCTTCAGTTTCTCTTTCAGTG No data
Right 1193524627 X:82573727-82573749 ACAAGGGTTCACCTGACTTTTGG No data
1193524621_1193524623 -4 Left 1193524621 X:82573681-82573703 CCTCTTCAGTTTCTCTTTCAGTG No data
Right 1193524623 X:82573700-82573722 AGTGATAGGAATTTAACACCAGG No data
1193524621_1193524625 7 Left 1193524621 X:82573681-82573703 CCTCTTCAGTTTCTCTTTCAGTG No data
Right 1193524625 X:82573711-82573733 TTTAACACCAGGAACTACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193524621 Original CRISPR CACTGAAAGAGAAACTGAAG AGG (reversed) Intergenic
No off target data available for this crispr