ID: 1193525341

View in Genome Browser
Species Human (GRCh38)
Location X:82581504-82581526
Sequence CAAATACTACGCATTTCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193525341_1193525346 17 Left 1193525341 X:82581504-82581526 CCATGGGAAATGCGTAGTATTTG No data
Right 1193525346 X:82581544-82581566 CCTCACGGCACACTCCTTCATGG No data
1193525341_1193525347 27 Left 1193525341 X:82581504-82581526 CCATGGGAAATGCGTAGTATTTG No data
Right 1193525347 X:82581554-82581576 CACTCCTTCATGGCTTTTCTTGG No data
1193525341_1193525343 2 Left 1193525341 X:82581504-82581526 CCATGGGAAATGCGTAGTATTTG No data
Right 1193525343 X:82581529-82581551 CTGGAATGCACCAATCCTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193525341 Original CRISPR CAAATACTACGCATTTCCCA TGG (reversed) Intergenic
No off target data available for this crispr