ID: 1193535229

View in Genome Browser
Species Human (GRCh38)
Location X:82707062-82707084
Sequence AGGGATATTCACTGTGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193535221_1193535229 24 Left 1193535221 X:82707015-82707037 CCTCCCTTTCTCTGTCAGCGGAC No data
Right 1193535229 X:82707062-82707084 AGGGATATTCACTGTGAGGTGGG No data
1193535222_1193535229 21 Left 1193535222 X:82707018-82707040 CCCTTTCTCTGTCAGCGGACTGA No data
Right 1193535229 X:82707062-82707084 AGGGATATTCACTGTGAGGTGGG No data
1193535223_1193535229 20 Left 1193535223 X:82707019-82707041 CCTTTCTCTGTCAGCGGACTGAA No data
Right 1193535229 X:82707062-82707084 AGGGATATTCACTGTGAGGTGGG No data
1193535226_1193535229 -8 Left 1193535226 X:82707047-82707069 CCATACTTCTCTCACAGGGATAT No data
Right 1193535229 X:82707062-82707084 AGGGATATTCACTGTGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193535229 Original CRISPR AGGGATATTCACTGTGAGGT GGG Intergenic
No off target data available for this crispr