ID: 1193547110

View in Genome Browser
Species Human (GRCh38)
Location X:82844357-82844379
Sequence CATAATTAACAGAGGCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193547107_1193547110 14 Left 1193547107 X:82844320-82844342 CCTAGCCATACAGGATTAGGTTA No data
Right 1193547110 X:82844357-82844379 CATAATTAACAGAGGCAGCATGG No data
1193547108_1193547110 9 Left 1193547108 X:82844325-82844347 CCATACAGGATTAGGTTAATTGA No data
Right 1193547110 X:82844357-82844379 CATAATTAACAGAGGCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193547110 Original CRISPR CATAATTAACAGAGGCAGCA TGG Intergenic
No off target data available for this crispr