ID: 1193551077

View in Genome Browser
Species Human (GRCh38)
Location X:82893413-82893435
Sequence TAATTTATGCAAAGGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193551077_1193551081 -10 Left 1193551077 X:82893413-82893435 CCATCCTTCCTTTGCATAAATTA No data
Right 1193551081 X:82893426-82893448 GCATAAATTATGCTGCAGCAGGG No data
1193551077_1193551083 24 Left 1193551077 X:82893413-82893435 CCATCCTTCCTTTGCATAAATTA No data
Right 1193551083 X:82893460-82893482 CCATACACCAGCAGATCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193551077 Original CRISPR TAATTTATGCAAAGGAAGGA TGG (reversed) Intergenic
No off target data available for this crispr